AMCG00008806 (hoxc8,hoxc8ab)


Basic Information

Item Value
gene id AMCG00008806
gene name hoxc8,hoxc8ab
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 12434623 ~ 12435063 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00008806
ATGAGCTCCTATTTCGTGAACCCTCTTTTCTCCAAATACAAAGCCGGCGAGTCTCTGGAACCAACTTACTACGACTGCCGGTTCCCTCAGAGCGTCAGCCGGAGCCACGCGTTGGTTTACGGTCCCGGAGCGGCGCCCACCGGCTTCCAGCACCCGTCCCACCACGTCCAGGACTTCTTCCACCACGGCACCTCCGGCATCTCCAACCCCGGATACCAGCAAAGCCCCTGCGCCCTGGCTTGCCACGGGGACGCCACCAAATTCTACGGATACGAAGCCCTTCCGAGGCAGTCGCTGTATGGCGCACAGCAAGAGCCCAGCGTAGCGCAATATGCAGACTGTAAATCGACTAACGGCGCTAACCCAGGAGACGGACAAGCCCACTTAAATCAAACTTCGTCTTCTAGTCTCATGTTTCCCTGGATGAGACCACACGGTTAG

Function

symbol description
hoxc8 Enables sequence-specific double-stranded DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to act upstream of or within several processes, including anterior/posterior pattern specification; negative regulation of transcription by RNA polymerase II; and skeletal system morphogenesis. Located in microtubule cytoskeleton and nucleoplasm.

NR:

description
PREDICTED: homeobox protein Hox-C8a isoform X2

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0007275 multicellular organism development biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG:

id description
K09308 HOX_8; homeobox protein HoxB/C/D8

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00008806 True 441 mRNA 0.58 1 12434623 12435063

Neighbor

gene id symbol gene type direction distance location
AMCG00008807 NA coding upstream 11217 12422714 ~ 12423406 (+)
AMCG00008809 NA coding upstream 19518 12399412 ~ 12415105 (+)
AMCG00008808 hoxc11,hoxc11a,LOC108433364 coding upstream 48321 12385580 ~ 12386302 (+)
AMCG00008803 NA coding upstream 75258 12358727 ~ 12359365 (+)
AMCG00008804 hoxc13,LOC107715003 coding upstream 95887 12337886 ~ 12338736 (+)
AMCG00008805 hoxc6ba,LOC108433405,LOC103034651 coding downstream 27975 12463038 ~ 12465622 (+)
AMCG00008812 NA coding downstream 33753 12468816 ~ 12469543 (+)
AMCG00008811 hoxc4 coding downstream 69193 12504256 ~ 12505029 (+)
AMCG00008819 NA coding downstream 133965 12569028 ~ 12569687 (+)
AMCG00008814 hnrnpa1 coding downstream 219504 12654567 ~ 12659732 (+)
G51665 NA non-coding upstream 8401 12425933 ~ 12426222 (+)
G51614 NA non-coding upstream 184714 12190733 ~ 12249909 (+)
G51586 NA non-coding upstream 354419 12078697 ~ 12080204 (+)
G51584 NA non-coding upstream 357110 12075488 ~ 12077513 (+)
G51582 NA non-coding upstream 372334 12062074 ~ 12062289 (+)
G51673 NA non-coding downstream 3788 12438851 ~ 12439523 (+)
G51685 NA non-coding downstream 68853 12503916 ~ 12504176 (+)
G51710 NA non-coding downstream 124408 12559471 ~ 12559699 (+)
G51718 NA non-coding downstream 211460 12646523 ~ 12647964 (+)
G51735 NA non-coding downstream 286019 12721082 ~ 12722980 (+)
AMCG00008784 NA other upstream 730210 11694654 ~ 11704413 (+)
G51445 NA other upstream 969135 11460363 ~ 11465488 (+)
G51297 NA other upstream 1393949 10984890 ~ 11040674 (+)
AMCG00008752 LOC107666323 other upstream 1588187 10828568 ~ 10846436 (+)
AMCG00008749 krt8,LOC108429286,LOC107705699,LOC107666380,LOC107681386,LOC107559866,LOC108411779,LOC106935308,LOC103152763,LOC102227940,LOC106915440 other upstream 1662948 10692377 ~ 10771675 (+)
AMCG00008810 NA other downstream 104535 12539598 ~ 12549618 (+)
G51734 NA other downstream 280431 12715494 ~ 12716786 (+)
G51756 NA other downstream 407652 12842715 ~ 12846233 (+)
G51812 NA other downstream 490175 12925238 ~ 12926794 (+)
AMCG00008837 march9,LOC107664138,LOC107593952,LOC107714987,LOC106583285 other downstream 545741 12980804 ~ 12992725 (+)

Expression


Co-expression Network