AMCG00008807


Basic Information

Item Value
gene id AMCG00008807
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 12422714 ~ 12423406 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00008807
ATGTCGACCACGGGTCCCATAAGCAACTATTATGTGGATTCATTGATAAACCATGAAAGCGAAGAAGTCTTGGCGGCTGCTCGCTTCTCGGCTCCGGGATCTCTCCCCTCGGGTTCCCGTCCGGCAGGCTTGGTACCAGAGTGTACCGATTTCCCCTCTTGCAGCTTTGCCCCAAAACCTCCCATCTTCACGACTTCCTGGGCCCCGGTGCAGTCCCAGTCCTCAGTGGTGTATCACCCCTACACGCATCAAACCCACTTAGGGACAGACTCCAGGTACGTGCGGTCTTGGCTGGAGCCTATCTCAGGCGCCGTGTCCTTCACCGGCTTCCCGGCCAACAGCAGACACTACGGGCTGAAACCCGACGCGTTCCCGGAGCGCAGGGTCGGGGATTGCCTGCCTCCCAACGCACGAAACTACTCGGATTATCTCTACGGGTCTTCGGCTGACATTCGCGACAGGACGGCGCAAAACATCCCCTCTCCGGAGTCCGAGGTTTTAGCTTCCAGCAAACACAAAGAGGAGAAGCCAGAATTAGACCCGACGCGAGGAGGCTGCCAGTACTAA

Function

GO:

id name namespace
GO:2001213 negative regulation of vasculogenesis biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00008807 True 567 mRNA 0.58 2 12422714 12423406

Neighbor

gene id symbol gene type direction distance location
AMCG00008809 NA coding upstream 7609 12399412 ~ 12415105 (+)
AMCG00008808 hoxc11,hoxc11a,LOC108433364 coding upstream 36412 12385580 ~ 12386302 (+)
AMCG00008803 NA coding upstream 63349 12358727 ~ 12359365 (+)
AMCG00008804 hoxc13,LOC107715003 coding upstream 83978 12337886 ~ 12338736 (+)
AMCG00008799 LOC106565462,LOC106583300,LOC105016995,LOC108424631,LOC106567065 coding upstream 185355 12236631 ~ 12237359 (+)
AMCG00008806 hoxc8,hoxc8ab coding downstream 11217 12434623 ~ 12435063 (+)
AMCG00008805 hoxc6ba,LOC108433405,LOC103034651 coding downstream 39632 12463038 ~ 12465622 (+)
AMCG00008812 NA coding downstream 45410 12468816 ~ 12469543 (+)
AMCG00008811 hoxc4 coding downstream 80850 12504256 ~ 12505029 (+)
AMCG00008819 NA coding downstream 145622 12569028 ~ 12569687 (+)
G51614 NA non-coding upstream 172805 12190733 ~ 12249909 (+)
G51586 NA non-coding upstream 342510 12078697 ~ 12080204 (+)
G51584 NA non-coding upstream 345201 12075488 ~ 12077513 (+)
G51582 NA non-coding upstream 360425 12062074 ~ 12062289 (+)
G51483 NA non-coding upstream 706232 11712712 ~ 11716482 (+)
G51665 NA non-coding downstream 2527 12425933 ~ 12426222 (+)
G51673 NA non-coding downstream 15445 12438851 ~ 12439523 (+)
G51685 NA non-coding downstream 80510 12503916 ~ 12504176 (+)
G51710 NA non-coding downstream 136065 12559471 ~ 12559699 (+)
G51718 NA non-coding downstream 223117 12646523 ~ 12647964 (+)
AMCG00008784 NA other upstream 718301 11694654 ~ 11704413 (+)
G51445 NA other upstream 957226 11460363 ~ 11465488 (+)
G51297 NA other upstream 1382040 10984890 ~ 11040674 (+)
AMCG00008752 LOC107666323 other upstream 1576278 10828568 ~ 10846436 (+)
AMCG00008749 krt8,LOC108429286,LOC107705699,LOC107666380,LOC107681386,LOC107559866,LOC108411779,LOC106935308,LOC103152763,LOC102227940,LOC106915440 other upstream 1651039 10692377 ~ 10771675 (+)
AMCG00008810 NA other downstream 116192 12539598 ~ 12549618 (+)
G51734 NA other downstream 292088 12715494 ~ 12716786 (+)
G51756 NA other downstream 419309 12842715 ~ 12846233 (+)
G51812 NA other downstream 501832 12925238 ~ 12926794 (+)
AMCG00008837 march9,LOC107664138,LOC107593952,LOC107714987,LOC106583285 other downstream 557398 12980804 ~ 12992725 (+)

Expression


Co-expression Network