AMCG00009006 (ect2,LOC107593151)


Basic Information

Item Value
gene id AMCG00009006
gene name ect2,LOC107593151
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 18036794 ~ 18040961 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00009006
GCCAACCTCCTGTCCTCGCACCGCATCCTGGTTCAGAGAGTAGAGACCATTGCGCTGGGAGAGAAGCCCTGTGATCGTGGAGAGCACGTCACCCTGTTCCTCTTCAATGACTGTCTTGAGATTGCGAGGAAGAGGCACAAGGTAATAACCACTTTCAGGAGTCCGCACGGAAACACACGCCCCCCCGCATCCCTGAAACACATCACCCTCATGCCTCTGTCTCAGATCAGAAAGGTCCTGGACCTGAAAGAAACTGAAGATTGCCAAAACGCCTTTGCCCTGGTGGTGCACCCTCCTACCGAGCAGGACAACCTGCTGTTCAGCTTCCAGATGACTGCCGAGGAGATGGGCAAGGAGGCCTGGCTGCGGACACTGTGCCGACACATTGCCAACACCATCTGTAAAGCAGATGCAGAGGAGCTAATCCAGAGCACAGACCCTGACACAGTGCAAGTGAACACCAAGGACATGGACAGTACACTGAGCCGAGCATCTAGGGCCATCAAGAAGACCTCGAAGAAG

Function

symbol description
ect2 Predicted to enable guanyl-nucleotide exchange factor activity. Acts upstream of or within cytokinetic process. Predicted to be located in cytoplasm. Predicted to be active in cell cortex and nucleus. Is expressed in midbrain. Orthologous to human ECT2 (epithelial cell transforming 2).

NR:

description
PREDICTED: protein ECT2 isoform X3

GO:

id name namespace
GO:0000902 cell morphogenesis biological_process
GO:0000910 cytokinesis biological_process
GO:0035023 regulation of Rho protein signal transduction biological_process
GO:0045666 positive regulation of neuron differentiation biological_process
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005096 GTPase activator activity molecular_function

KEGG:

id description
K20704 ECT2, ARHGEF31; protein ECT2

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00009006 True 522 mRNA 0.55 4 18036794 18040961

Neighbor

gene id symbol gene type direction distance location
AMCG00009008 NA coding upstream 14475 18013706 ~ 18022319 (+)
AMCG00009010 NA coding upstream 32053 17976034 ~ 18004741 (+)
AMCG00009007 NA coding upstream 121098 17899078 ~ 17915696 (+)
AMCG00009002 LOC103358380 coding upstream 167836 17863809 ~ 17868958 (+)
AMCG00009004 med25,LOC106601541,LOC106601511 coding upstream 191126 17831943 ~ 17845668 (+)
AMCG00009014 NA coding downstream 178111 18219072 ~ 18220253 (+)
AMCG00009016 rfc4,LOC103355474 coding downstream 320565 18361526 ~ 18374268 (+)
AMCG00009026 LOC107550661,LOC107566880 coding downstream 1820317 19861278 ~ 19915906 (+)
AMCG00009025 atp11b coding downstream 1898115 19939076 ~ 19949435 (+)
AMCG00009032 NA coding downstream 2222114 20263075 ~ 20263866 (+)
G53366 NA non-coding upstream 152107 17884481 ~ 17884687 (+)
G53358 NA non-coding upstream 162139 17872802 ~ 17874655 (+)
G53353 NA non-coding upstream 164127 17871429 ~ 17872667 (+)
G53354 NA non-coding upstream 165728 17870507 ~ 17871066 (+)
G53352 NA non-coding upstream 166327 17868996 ~ 17870467 (+)
G53406 NA non-coding downstream 36710 18077671 ~ 18077878 (+)
G53409 NA non-coding downstream 42843 18083804 ~ 18084038 (+)
G53410 NA non-coding downstream 43357 18084318 ~ 18084530 (+)
G53414 NA non-coding downstream 55269 18096230 ~ 18098551 (+)
G53415 NA non-coding downstream 58055 18099016 ~ 18099647 (+)
AMCG00009009 NA other upstream 116202 17917548 ~ 17920592 (+)
G53298 mybpc2 other upstream 306134 17729366 ~ 17730660 (+)
AMCG00008995 NA other upstream 693118 17330892 ~ 17343676 (+)
AMCG00008986 shank1,LOC108427331 other upstream 1285996 16746687 ~ 16750798 (+)
AMCG00008988 shank1,LOC108427331,LOC103392692 other upstream 1299295 16731389 ~ 16737499 (+)
G53520 NA other downstream 509811 18550772 ~ 18553960 (+)
AMCG00009022 dnajc19,LOC107727073 other downstream 1486936 19527897 ~ 19547507 (+)
AMCG00009033 nlgn1,LOC103399994,LOC102210587,LOC102311540 other downstream 2335834 20376795 ~ 20396356 (+)
G53911 NA other downstream 3127270 21168231 ~ 21168575 (+)
G53915 NA other downstream 3233650 21274611 ~ 21275354 (+)

Expression


Co-expression Network