AMCG00009034 (nlgn1)


Basic Information

Item Value
gene id AMCG00009034
gene name nlgn1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 20456457 ~ 20461014 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00009034
ATGTTCTTGAATGCTCTGTTTCCTCCATTGTCTCCATTCTTGATCCTAGGTCCCCTTACAAAGAAACAGAATGATGATTTAGGTGATAATGAAGGTGCAGAGGATGAAGACATTCGTGAAAGTGGAAGCCCGAAGCCTGTAATGGTTTTTATCCATGGGGGCTCATACATGGAAGGCACCGGAAATATGTTTGACGGGAGCATTTTGGCAAGCTATGGTAATGTGATTGTCATCACGGTTAACTACCGGCTTGGGGTTTTA

Function

symbol description
nlgn1 Predicted to enable neurexin family protein binding activity and signaling receptor activity. Acts upstream of or within sprouting angiogenesis. Predicted to be located in excitatory synapse and plasma membrane. Predicted to be integral component of membrane. Predicted to be active in cell surface and synapse. Predicted to be integral component of plasma membrane. Is expressed in several structures, including brain; cardiovascular system; eye; gonad; and swim bladder. Orthologous to human NLGN1 (neuroligin 1).

NR:

description
PREDICTED: neuroligin-1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00009034 True 261 mRNA 0.44 2 20456457 20461014

Neighbor

gene id symbol gene type direction distance location
AMCG00009032 NA coding upstream 192591 20263075 ~ 20263866 (+)
AMCG00009025 atp11b coding upstream 507022 19939076 ~ 19949435 (+)
AMCG00009026 LOC107550661,LOC107566880 coding upstream 540551 19861278 ~ 19915906 (+)
AMCG00009016 rfc4,LOC103355474 coding upstream 2082189 18361526 ~ 18374268 (+)
AMCG00009014 NA coding upstream 2236204 18219072 ~ 18220253 (+)
AMCG00009035 nlgn1,LOC106584306 coding downstream 225131 20686145 ~ 20692387 (+)
AMCG00009038 NA coding downstream 536884 20997898 ~ 21087025 (+)
AMCG00009042 NA coding downstream 1969326 22430340 ~ 22441467 (+)
AMCG00009043 NA coding downstream 2152338 22613352 ~ 22631352 (+)
AMCG00009049 trpc1 coding downstream 2171703 22632717 ~ 22648476 (+)
G53812 NA non-coding upstream 139423 20290778 ~ 20317034 (+)
G53803 NA non-coding upstream 184643 20263496 ~ 20271814 (+)
G53793 LOC107745311 non-coding upstream 243655 20136632 ~ 20212802 (+)
G53791 NA non-coding upstream 352457 20103780 ~ 20104000 (+)
G53764 NA non-coding upstream 426026 20030156 ~ 20030431 (+)
G53855 NA non-coding downstream 170434 20631448 ~ 20724272 (+)
G53877 NA non-coding downstream 273341 20734355 ~ 20734623 (+)
G53878 NA non-coding downstream 298655 20759669 ~ 20759870 (+)
G53882 NA non-coding downstream 444039 20905053 ~ 20905348 (+)
G53884 NA non-coding downstream 448880 20909894 ~ 20910148 (+)
AMCG00009033 nlgn1,LOC103399994,LOC102210587,LOC102311540 other upstream 60101 20376795 ~ 20396356 (+)
AMCG00009022 dnajc19,LOC107727073 other upstream 908950 19527897 ~ 19547507 (+)
G53520 NA other upstream 1902497 18550772 ~ 18553960 (+)
AMCG00009009 NA other upstream 2535865 17917548 ~ 17920592 (+)
G53298 mybpc2 other upstream 2725797 17729366 ~ 17730660 (+)
G53911 NA other downstream 707217 21168231 ~ 21168575 (+)
G53915 NA other downstream 813597 21274611 ~ 21275354 (+)
G53917 NA other downstream 831227 21292241 ~ 21293901 (+)
G54263 NA other downstream 3422303 23883317 ~ 23975906 (+)
AMCG00009085 NA other downstream 4351604 24812618 ~ 24816534 (+)

Expression


Co-expression Network