AMCG00009113 (hs6st1a,LOC107678693,LOC107727332)



Basic Information


Item Value
gene id AMCG00009113
gene name hs6st1a,LOC107678693,LOC107727332
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 25942125 ~ 25950002 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00009113
ATGTCTAGGAAATTCTACTACATCACCCTGCTCCGGGATCCCGTGTCGCGCTACCTGAGTGAGTGGAGGCATGTGCAGCGGGGGGCCACCTGGAAGACTTCCCTCCACATGTGTGATGGGCGCACCCCCACCCCTGAGGAGCTTCCCTCCTGCTACGAGGGCACGGACTGGTCTGGGTGCACCCTGCAACAATTCATGGAGTGCCCTTACAACCTGGCCAACAACCGCCAGGTGCGGATGTTGGCTGACCTGAGCCTTGTGGGATGCTACAATATGTCCTTCATCCCTGAGAAGAAGAGGGCCCAGATCCTCCTGGAGAGCGCCAAGAAGAACCTGAGGGATATGGCGTTCTTCGGGCTGACCGAGTTCCAGCGCAAGACCCAGTACCTCTTCGAGAGGACCTTTAAGCTCAAGTTCATCCGCCCCTTCATGCAGTACAACAGCACCAGGGCGGCCGGGGTGGATGTGGACAACGACACCATCCTGCGCATCGAGGAGCTCAATGACTTGGACATGCAGCTCTATGACTATGCCAAGGACCTTTTCCAGCAGCGTTATCAGTACAAGCGCCAGCTGGACCGCCGGGAGCAAAAGATACGGAGCCGGGAGGACTACCGCCAGCACCGCTCCAACGAGGATCCCCTAAGAGACGATGCAGAAGATCCAGCCCGTCTTCCCACCGAGGATTATATGAACCACATTATTAACAGGTGGTAG

Function


symbol description
hs6st1a Enables heparan sulfate 6-O-sulfotransferase activity. Predicted to be involved in heparan sulfate proteoglycan biosynthetic process, enzymatic modification. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including immature eye; nervous system; neural keel; neural tube; and polster. Human ortholog(s) of this gene implicated in hypogonadotropic hypogonadism 15 with or without anosmia. Orthologous to human HS6ST1 (heparan sulfate 6-O-sulfotransferase 1).

NR:

description
heparan sulfate 6-O-sulfotransferase 1

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component
GO:0017095 heparan sulfate 6-O-sulfotransferase activity molecular_function

KEGG:

id description
K02514 HS6ST1; heparan sulfate 6-O-sulfotransferase HS6ST1

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00009113 True 717 mRNA 0.57 2 25942125 25950002
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00009112 uggt1,LOC107748935,LOC107683622,LOC107727334 coding downstream 10630 25887411 ~ 25931495 (-)
AMCG00009101 NA coding downstream 519312 25404668 ~ 25422813 (-)
AMCG00009103 NA coding downstream 573711 25350519 ~ 25368414 (-)
AMCG00009102 NA coding downstream 640652 25294961 ~ 25301473 (-)
AMCG00009098 NA coding downstream 772943 25162585 ~ 25169182 (-)
AMCG00009114 hs6st1,hs6st1a,LOC107602601,LOC107588870,LOC107727332,LOC107748934,LOC107678693 coding upstream 109539 26059541 ~ 26060656 (-)
AMCG00009118 NA coding upstream 524677 26474679 ~ 26483701 (-)
AMCG00009120 NA coding upstream 540875 26490877 ~ 26494273 (-)
AMCG00009119 NA coding upstream 564124 26514126 ~ 26520134 (-)
AMCG00009124 NA coding upstream 665927 26615929 ~ 26624943 (-)
G54613 NA non-coding downstream 418100 25522121 ~ 25524025 (-)
G54610 NA non-coding downstream 427107 25512833 ~ 25515018 (-)
G54598 NA non-coding downstream 453497 25486977 ~ 25488628 (-)
G54597 NA non-coding downstream 455637 25486070 ~ 25486488 (-)
G54594 NA non-coding downstream 463224 25478688 ~ 25478901 (-)
G54682 NA non-coding upstream 140377 26090379 ~ 26090785 (-)
G54697 NA non-coding upstream 300544 26250546 ~ 26250857 (-)
G54706 NA non-coding upstream 457581 26407583 ~ 26407864 (-)
G54792 NA non-coding upstream 676804 26626806 ~ 26649993 (-)
G54797 NA non-coding upstream 728248 26678250 ~ 26678588 (-)
AMCG00009105 NA other downstream 410559 25529829 ~ 25531566 (-)
AMCG00009106 NA other downstream 479435 25460606 ~ 25462690 (-)
AMCG00009100 NA other downstream 765747 25173677 ~ 25176378 (-)
G54544 NA other downstream 785787 25153266 ~ 25156338 (-)
AMCG00009060 hltf other downstream 2079090 23825229 ~ 23863035 (-)
AMCG00009121 NA other upstream 572631 26522633 ~ 26532410 (-)
G54821 NA other upstream 843539 26793541 ~ 26796654 (-)
AMCG00009148 NA other upstream 1160994 27110996 ~ 27153475 (-)
AMCG00009151 NA other upstream 1364315 27314317 ~ 27335731 (-)
AMCG00009165 rpl35a,LOC106612432 other upstream 1663596 27613598 ~ 27618172 (-)

Expression


AMCG00009113(hs6st1a,LOC107678693,LOC107727332) Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

AMCG00009113(hs6st1a,LOC107678693,LOC107727332) Expression in each Bioproject

Bar chart with 7 bars.
AMCG00009113(hs6st1a,LOC107678693,LOC107727332) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network


Homologous


species gene id symbol gene type chromosome NCBI id location
mexican tetra (Astyanax mexicanus) G321023 hs6st1,hs6st1a,LOC108428903,LOC107748934,LOC108267822 non-coding NW_019172889.1 APWO02000084.1 458257 ~ 514514 (-)