AMCG00009114 (hs6st1,hs6st1a,LOC107602601,LOC107588870,LOC107727332,LOC107748934,LOC107678693)


Basic Information

Item Value
gene id AMCG00009114
gene name hs6st1,hs6st1a,LOC107602601,LOC107588870,LOC107727332,LOC107748934,LOC107678693
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 26059541 ~ 26060656 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00009114
ATGGTTGAGAGGACCAGTAAATTTCTGTTGATCGTTGTCGGATCCATCTTTTTCATGCTGATTTTGTACCAGTACGTGGCTCCCGGGATGATGAACTTCGGGTCCCCGCACGGGTACCTCCTGGAGGACGACGCAGATATCTTCCCGACCCCAGATCCCCACTATGTGAAGAAGTACTATTTTCCCATCAGGGACCTGGATCGCTCGGTGGATTTCGAAATCAAAGGCGAGGATGTGATCGTCTTTCTGCACATCCAGAAAACGGGGGGGACCACTTTTGGGAGGCATTTGGTGCAAAACGTGAGGCTGGAGGTGCCGTGCGACTGCAGACCCGGGCAGAAGAAGTGTACCTGCTACCGGCCCAACAGGAAGGAGACCTGGCTCTTCTCCCGCTTCTCCACGGGCTGGAGCTGCGGGCTGCACGCCGACTGGACCGAGCTCACCAACTGCGTGCCGGGGGTGCTCAACAAGAAGGAGAATAAATTTAAAAACCTGAGGTATGGTGAAATCCAGCGATGA

Function

symbol description
hs6st1a Enables heparan sulfate 6-O-sulfotransferase activity. Predicted to be involved in heparan sulfate proteoglycan biosynthetic process, enzymatic modification. Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in several structures, including immature eye; nervous system; neural keel; neural tube; and polster. Human ortholog(s) of this gene implicated in hypogonadotropic hypogonadism 15 with or without anosmia. Orthologous to human HS6ST1 (heparan sulfate 6-O-sulfotransferase 1).
hs6st1 Predicted to enable heparan sulfate 6-O-sulfotransferase activity. Involved in neuron development. Predicted to be located in Golgi membrane. Predicted to be integral component of plasma membrane. Implicated in hypogonadotropic hypogonadism 15 with or without anosmia.

NR:

description
PREDICTED: heparan-sulfate 6-O-sulfotransferase 1-A

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component
GO:0017095 heparan sulfate 6-O-sulfotransferase activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00009114 True 519 mRNA 0.55 2 26059541 26060656

Neighbor

gene id symbol gene type direction distance location
AMCG00009113 hs6st1a,LOC107678693,LOC107727332 coding downstream 109539 25942125 ~ 25950002 (-)
AMCG00009112 uggt1,LOC107748935,LOC107683622,LOC107727334 coding downstream 128046 25887411 ~ 25931495 (-)
AMCG00009101 NA coding downstream 636728 25404668 ~ 25422813 (-)
AMCG00009103 NA coding downstream 691127 25350519 ~ 25368414 (-)
AMCG00009102 NA coding downstream 758068 25294961 ~ 25301473 (-)
AMCG00009118 NA coding upstream 414023 26474679 ~ 26483701 (-)
AMCG00009120 NA coding upstream 430221 26490877 ~ 26494273 (-)
AMCG00009119 NA coding upstream 453470 26514126 ~ 26520134 (-)
AMCG00009124 NA coding upstream 555273 26615929 ~ 26624943 (-)
AMCG00009125 fbxo45,LOC106590630,LOC106578473 coding upstream 569956 26630612 ~ 26635364 (-)
G54613 NA non-coding downstream 535516 25522121 ~ 25524025 (-)
G54610 NA non-coding downstream 544523 25512833 ~ 25515018 (-)
G54598 NA non-coding downstream 570913 25486977 ~ 25488628 (-)
G54597 NA non-coding downstream 573053 25486070 ~ 25486488 (-)
G54594 NA non-coding downstream 580640 25478688 ~ 25478901 (-)
G54682 NA non-coding upstream 29723 26090379 ~ 26090785 (-)
G54697 NA non-coding upstream 189890 26250546 ~ 26250857 (-)
G54706 NA non-coding upstream 346927 26407583 ~ 26407864 (-)
G54792 NA non-coding upstream 566150 26626806 ~ 26649993 (-)
G54797 NA non-coding upstream 617594 26678250 ~ 26678588 (-)
AMCG00009105 NA other downstream 527975 25529829 ~ 25531566 (-)
AMCG00009106 NA other downstream 596851 25460606 ~ 25462690 (-)
AMCG00009100 NA other downstream 883163 25173677 ~ 25176378 (-)
G54544 NA other downstream 903203 25153266 ~ 25156338 (-)
AMCG00009060 hltf other downstream 2196506 23825229 ~ 23863035 (-)
AMCG00009121 NA other upstream 461977 26522633 ~ 26532410 (-)
G54821 NA other upstream 732885 26793541 ~ 26796654 (-)
AMCG00009148 NA other upstream 1050340 27110996 ~ 27153475 (-)
AMCG00009151 NA other upstream 1253661 27314317 ~ 27335731 (-)
AMCG00009165 rpl35a,LOC106612432 other upstream 1552942 27613598 ~ 27618172 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_023522 hs6st1b coding NC_007135.7 CM002908.2 27783946 ~ 27879182 (-)
grasscarp (Ctenopharyngodon idella) CI01000082_00847325_00903986 HS6ST1B, HS6ST1, HS6ST1A coding CI01000082 null 847325 ~ 903986 (-)