AMCG00009242 (xxylt1,LOC106573863,LOC107718247)


Basic Information

Item Value
gene id AMCG00009242
gene name xxylt1,LOC106573863,LOC107718247
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 30129788 ~ 30138314 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00009242
ATGCGGACAGTCTGCCTGAGCTGCACCTCAAAGTGGCACACTTTCTGGCAGTACCGGCGAGAGAATCCCAAATCAAAAGTGGGGGACCCTCCTCCGGATGGCATGCCGGGCTTCAACAGCGGGGTGATGCTGCTGGACCTGGAAGCCATGCAGGGCTCAGTGCTCTACAACCAGCTGCTGGAGCCAAGCAGCGTGGCCCAGCTGGCAGACAAGTACCACTTCAAGGGACACCTGGGTGACCAGGACTTCTTCACCATGATCGGCATGGAGCATCCCGGCCTCTTCCACACACTGGCCTGCGGCTGGAACCGCCAGCTCTGCACCTGGTGGAGGGAGCATGGCTATGGAGACATCTTCCAGCTATACTACCACTGCGATGGGCCTGTCAGGATCTACCACGGCAACTGCAACACTCCTATCCCCGATGACTGA

Function

symbol description
xxylt1 Predicted to enable UDP-xylosyltransferase activity. Predicted to be located in membrane. Predicted to be integral component of endoplasmic reticulum membrane. Orthologous to human XXYLT1 (xyloside xylosyltransferase 1).

NR:

description
PREDICTED: xyloside xylosyltransferase 1

GO: NA

KEGG:

id description
K23800 XXYLT1; xylosyl alpha-1,3-xylosyltransferase

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00009242 True 432 mRNA 0.59 2 30129788 30138314

Neighbor

gene id symbol gene type direction distance location
AMCG00009236 lsg1,LOC107573872,LOC107715771 coding downstream 131305 29991576 ~ 29998483 (-)
AMCG00009233 atp13a3,LOC106613657 coding downstream 174018 29930106 ~ 29955770 (-)
AMCG00009234 NA coding downstream 202330 29908609 ~ 29927458 (-)
AMCG00009232 NA coding downstream 423985 29705333 ~ 29705803 (-)
AMCG00009228 NA coding downstream 487876 29636991 ~ 29641912 (-)
AMCG00009243 xxylt1,LOC107715806,LOC106573863,LOC107718247 coding upstream 24106 30162420 ~ 30171530 (-)
AMCG00009244 NA coding upstream 42767 30181081 ~ 30185651 (-)
AMCG00009240 NA coding upstream 98594 30236908 ~ 30244496 (-)
AMCG00009255 psmd1 coding upstream 355346 30493660 ~ 30515776 (-)
AMCG00009254 psmd1 coding upstream 398536 30536850 ~ 30542295 (-)
G55610 NA non-coding downstream 153519 29975629 ~ 29976269 (-)
G55551 NA non-coding downstream 367623 29759527 ~ 29762165 (-)
G55488 NA non-coding downstream 670961 29458615 ~ 29458827 (-)
G55404 NA non-coding downstream 1072547 29055713 ~ 29057241 (-)
G55359 NA non-coding downstream 1235905 28843473 ~ 28893883 (-)
G55648 NA non-coding upstream 97845 30236159 ~ 30236395 (-)
G55703 NA non-coding upstream 342465 30480779 ~ 30483373 (-)
G55722 NA non-coding upstream 352924 30491238 ~ 30491980 (-)
G55760 NA non-coding upstream 514598 30652912 ~ 30655021 (-)
G55861 NA non-coding upstream 671262 30809576 ~ 30816091 (-)
AMCG00009235 NA other downstream 138978 29977937 ~ 29990810 (-)
AMCG00009229 ccd50,LOC106613514 other downstream 424859 29660960 ~ 29704929 (-)
AMCG00009215 gpr17 other downstream 1066758 29057941 ~ 29063030 (-)
AMCG00009186 LOC101485254,LOC105936810,LOC108230674,LOC100697045,LOC107392689 other downstream 1739692 28385083 ~ 28390096 (-)
AMCG00009165 rpl35a,LOC106612432 other downstream 2511616 27613598 ~ 27618172 (-)
AMCG00009241 NA other upstream 111557 30249871 ~ 30256499 (-)
AMCG00009265 NA other upstream 461160 30599474 ~ 30657612 (-)
G55878 NA other upstream 796250 30934564 ~ 30937251 (-)
G55881 NA other upstream 806053 30944367 ~ 30947211 (-)
AMCG00009269 NA other upstream 834639 30972953 ~ 30985995 (-)

Expression


Co-expression Network