AMCG00009391 (p2ry1)


Basic Information

Item Value
gene id AMCG00009391
gene name p2ry1
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 36873672 ~ 36874729 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00009391
ACAACATGACAGCAGAATTCAACTTGACTGCACTTTTGAATGTCTCAGAGATAGAAAGCCCTATCAAAGCATGCTCCCTGACGAGGACTGGCTTTCAGTTCTACTACCTGCCCACTGTTTACATCCTGGTCTTCATCACTGGACTGATTGGGAACAGCAGAAACGCCACCACTTGCTACGACACCACGACGGAGGATGAGCTGCCCAGTTACTTCATCTACAGCATGTGCACCACTGTGTTCGGCTTCTGCATCCCCTTCATGATCATCCTTGGCTGCTATGGCTTGATCGCCAAAGCGCTGATCACCAACGACATGAACAACGCGCCGTTGAGGAGGAAGTCCATCCACCTGGTGATCATCGTGCTGGCGGTGTTTGCCGTGTCCTATCTCCCCTTCCACGTCATGAAGAACCTGAACCTCAGGGCCAGGCTGTACTTCCAGAGTTCAGAGATGTGTGATTTCAATAACCGGGTGTACGCCACCTACCAAGTAACTCGAGGGCTCGCCAGCTTGAATAGCTGCGTGGATCCAATTTTATACTTTCTGGCCGGGGACACATTCCGGCGACGATTGTCCAGAGCCACCAGAAAAAACTCCAAACGAAGTGACAACACTCTGCAGTCCAAAAGCGAGGAAACTGCCCTCCACATCGTCTCTGAATACACTCAGAATGGAGATACG

Function

symbol description
p2ry1 Predicted to enable ATP binding activity and G protein-coupled purinergic nucleotide receptor activity. Predicted to act upstream of or within phospholipase C-activating G protein-coupled receptor signaling pathway; platelet activation; and relaxation of muscle. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Orthologous to human P2RY1 (purinergic receptor P2Y1).

NR:

description
PREDICTED: P2Y purinoceptor 1

GO: NA

KEGG:

id description
K04270 P2RY1; P2Y purinoceptor 1

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00009391 True 683 mRNA 0.51 2 36873672 36874729

Neighbor

gene id symbol gene type direction distance location
AMCG00009389 rap2b coding downstream 33335 36840116 ~ 36840337 (-)
AMCG00009388 NA coding downstream 105952 36733179 ~ 36767720 (-)
AMCG00009382 NA coding downstream 209941 36640234 ~ 36663731 (-)
AMCG00009384 NA coding downstream 250175 36620406 ~ 36623497 (-)
AMCG00009385 NA coding downstream 297199 36576207 ~ 36576473 (-)
AMCG00009390 mbnl1 coding upstream 25564 36900293 ~ 36921139 (-)
AMCG00009394 NA coding upstream 214054 37088783 ~ 37097327 (-)
AMCG00009407 NA coding upstream 400733 37275462 ~ 37277549 (-)
AMCG00009411 NA coding upstream 404157 37278886 ~ 37279752 (-)
AMCG00009406 tsc22d2,LOC107097579,LOC107727513,LOC105899227 coding upstream 425799 37300528 ~ 37305420 (-)
G56710 p2ry1 non-coding downstream 1849 36869548 ~ 36871823 (-)
G56612 NA non-coding downstream 480154 36096808 ~ 36393518 (-)
G56611 NA non-coding downstream 768253 36080635 ~ 36105419 (-)
G56570 NA non-coding downstream 983990 35889450 ~ 35889682 (-)
G56564 NA non-coding downstream 1059458 35782424 ~ 35814214 (-)
G56742 NA non-coding upstream 293265 37167994 ~ 37168244 (-)
G56795 NA non-coding upstream 326303 37201032 ~ 37267831 (-)
G56818 tsc22d2,LOC105899227 non-coding upstream 425815 37300544 ~ 37367669 (-)
G56831 LOC106583953,LOC106560594 non-coding upstream 543685 37418414 ~ 37422521 (-)
G56861 NA non-coding upstream 641240 37515969 ~ 37517654 (-)
G56568 NA other downstream 1001075 35872123 ~ 35872597 (-)
G56546 LOC103376870 other downstream 1333862 35538887 ~ 35539810 (-)
AMCG00009347 gmps other downstream 2511331 34334261 ~ 34362341 (-)
G56438 kcnab1a,kcnab1,LOC107671078,LOC107675612,LOC107566585,LOC108263953 other downstream 2557664 34239484 ~ 34316008 (-)
AMCG00009342 kcnab1 other downstream 2599588 34227274 ~ 34274084 (-)
G56800 NA other upstream 341231 37215960 ~ 37220076 (-)
AMCG00009409 selenot,LOC107681817,LOC106599070,LOC107708642 other upstream 405819 37280548 ~ 37285365 (-)
AMCG00009408 NA other upstream 410847 37285576 ~ 37394988 (-)
AMCG00009417 NA other upstream 592525 37467254 ~ 37476035 (-)
AMCG00009437 NA other upstream 1014773 37889502 ~ 37908968 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000017_00419470_00420564 P2RY1 coding CI01000017 null 418525 ~ 420564 (-)