AMCG00009529


Basic Information

Item Value
gene id AMCG00009529
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 40436327 ~ 40441597 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00009529
ATGCTGGAACAGGGGACTGTTGTCTATCAACACCTCTATAATATGGAAAGTCACTTCCTGGAGCTGCTGAACCGTTCCGAGCGTTCCCTGCAGGAGGCGTTCCCCACGGTGTACGGCGAGCTGTACACCCAGAACGCCCGCATCTTCCTGGACCTGTACGGCGAGCTGCGGCGCTACTACCGCGGCTCCAACTCCATCAACCTGGAGGAGGCGCTCAACGAGTTCTGGGTGCGGCTCCTGGAGCGGCTCTTCAAGGCCCTGAACCCACAGTACGTGATCGGCGACGACTACCTGGAGTGCGTCGTGAAGCAGACGGAGAAGCTGCGGCCCTTCGGCGAGGTGCCCCGGGACCTCAAACTCAAGGCCACCCGCGCCTTCATCGCTGCCCGGTCGTTCGTCCAGGGGCTGTGGGTCAGCAGCGAGGTGGTGCGCAAGGTCTCCCAGTCGTCGACGGGGCCGGCGTTCTCGATTTCCGCAGTGGAGTGCAGCGCCGATGCGTTTGCTGCTGGCGAGGGGCGCTTTTCGGAGGTGTGCTCGGTGTAG

Function

GO:

id name namespace
GO:0031225 anchored component of membrane cellular_component
GO:0005886 plasma membrane cellular_component
GO:0043395 heparan sulfate proteoglycan binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00009529 True 543 mRNA 0.63 3 40436327 40441597

Neighbor

gene id symbol gene type direction distance location
AMCG00009530 NA coding upstream 15455 40412213 ~ 40420872 (+)
AMCG00009524 NA coding upstream 215958 40212648 ~ 40220369 (+)
AMCG00009525 LOC106584350,LOC105907042,LOC106599532 coding upstream 233214 40189141 ~ 40203113 (+)
AMCG00009514 rpp21,LOC107653575,LOC107588084 coding upstream 257277 40172966 ~ 40179050 (+)
AMCG00009515 NA coding upstream 294047 40140469 ~ 40142280 (+)
AMCG00009526 NA coding downstream 7222 40448819 ~ 40462899 (+)
AMCG00009533 LOC107384019,LOC106568850 coding downstream 165539 40607136 ~ 40608113 (+)
AMCG00009534 LOC106599529,LOC105018039 coding downstream 202797 40644394 ~ 40652818 (+)
AMCG00009535 LOC106599529,LOC106568848,LOC103359190,LOC108430182 coding downstream 236256 40677853 ~ 40694380 (+)
AMCG00009536 LOC104966469,LOC106907045,LOC107600086,LOC103359190 coding downstream 263929 40705526 ~ 40711491 (+)
G57544 NA non-coding upstream 92946 40339382 ~ 40343381 (+)
G57523 NA non-coding upstream 276701 40159409 ~ 40159626 (+)
G57457 NA non-coding upstream 402994 40030546 ~ 40033333 (+)
G57428 NA non-coding upstream 493291 39941222 ~ 39943036 (+)
G57401 NA non-coding upstream 561157 39874881 ~ 39875170 (+)
G57597 NA non-coding downstream 387475 40829072 ~ 40829677 (+)
G57599 NA non-coding downstream 491370 40932967 ~ 40933210 (+)
G57690 NA non-coding downstream 1058367 41499964 ~ 41500218 (+)
G57770 NA non-coding downstream 1307958 41749555 ~ 41750144 (+)
G57775 NA non-coding downstream 1374324 41815921 ~ 41817795 (+)
AMCG00009516 NA other upstream 331275 40086474 ~ 40105052 (+)
G57430 NA other upstream 487127 39948006 ~ 39949200 (+)
AMCG00009480 sst1.1,LOC106579799,LOC105009822,LOC107586749,LOC103023622,LOC107582287 other upstream 999310 39434900 ~ 39437017 (+)
G57105 NA other upstream 1978735 38442255 ~ 38457592 (+)
AMCG00009428 NA other upstream 2819631 37608305 ~ 37616696 (+)
G57604 NA other downstream 549205 40990802 ~ 40994659 (+)
AMCG00009563 camk2n1a,camk2n2,LOC107659987,LOC108443638,LOC107557885,LOC103024774 other downstream 1154632 41596229 ~ 41599124 (+)
G57830 NA other downstream 1594421 42036018 ~ 42078241 (+)
AMCG00009647 NA other downstream 2995393 43436990 ~ 43444420 (+)
G58324 NA other downstream 3491355 43932952 ~ 43935762 (+)

Expression


Co-expression Network