AMCG00009633 (kcnd1,LOC107584898,LOC107601760,LOC106572071)


Basic Information

Item Value
gene id AMCG00009633
gene name kcnd1,LOC107584898,LOC107601760,LOC106572071
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 43105479 ~ 43112950 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00009633
ATGGAATGGGTAAAGCTGCCGTGCAATACTGCACTGATGCCCAGAGTGTGCAGTGGTACGGCAGTAACATTGCCGATAAACCTCCTACGCACTGTGGTCAAACTCCCATCTGAAACCCTGACATCCTCTCAGGGGAACGTGGCTTCACGTCAAGACCGACTCACCGGTAACCAGGCGCTGTGTGTGAGGAACCGGTCCTCCTTCGAGCAGCAGCACCACCACCTGCTGCACTGCTTGGAGAAGACCACAAACCACGAGTTCACGGATGAGCACACCTACAGTGAAGTGTGCATGGCGGAGTCGGTGGGCTACCGGACCAGCCGCAGCACGTCCATCTCCAGCCAGCAGGGCCTCTCCACCTCCTGCTGCCCGCGCCGCGCCAAGAGGAGGGCCATCCGGCTGGCCAACTCCACTGTGTCGGTCAGCCGTGGCAGCGTCCAGGAGCTGGACACTCTGCACGCGCACAAAACCAGCGGTGGCCACCAGAGCCGCTCCAGCCTGAACGCCAGGACCCAGGACCTGAAGCTGAACTGCGACGACACCGACTTCACCGCCGCCATCATCAGCATCCCCACGCCGCCCGCCAACACCCCCGACGAGAGCCTGCCCCCGTCGCCCGCCATCCCCGGCATCCTGCGCAACTCACGCCAGGTGGGCAGCACGGCCAGCACCTACACCCAGGAGACGGTCAAGATCTCCTCCTTATAA

Function

symbol description
kcnd1 Predicted to enable A-type (transient outward) potassium channel activity. Predicted to be involved in potassium ion transmembrane transport. Predicted to act upstream of or within several processes, including potassium ion transport; protein homooligomerization; and regulation of ion transmembrane transport. Predicted to be located in cell projection and membrane. Predicted to be part of voltage-gated potassium channel complex. Predicted to be active in dendritic spine; postsynaptic density; and postsynaptic membrane. Predicted to be integral component of membrane. Orthologous to human KCND1 (potassium voltage-gated channel subfamily D member 1).

NR:

description
PREDICTED: potassium voltage-gated channel subfamily D member 1-like

GO:

id name namespace
GO:0071805 potassium ion transmembrane transport biological_process
GO:0034765 regulation of ion transmembrane transport biological_process
GO:0051260 protein homooligomerization biological_process
GO:0008076 voltage-gated potassium channel complex cellular_component
GO:0005251 delayed rectifier potassium channel activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00009633 True 708 mRNA 0.63 5 43105479 43112950

Neighbor

gene id symbol gene type direction distance location
AMCG00009632 kcnd1,LOC107601760,LOC107584898 coding upstream 53088 43051273 ~ 43052391 (+)
AMCG00009631 NA coding upstream 102157 42977129 ~ 43003322 (+)
AMCG00009626 mon1b coding upstream 133101 42960967 ~ 42972378 (+)
AMCG00009628 NA coding upstream 178422 42914780 ~ 42927057 (+)
AMCG00009627 nt5dc2,LOC107678756,LOC107731170,LOC108442396,LOC107745746,LOC107668043 coding upstream 191987 42891698 ~ 42913492 (+)
AMCG00009636 NA coding downstream 76655 43189605 ~ 43213919 (+)
AMCG00009639 NA coding downstream 139252 43252202 ~ 43253062 (+)
AMCG00009634 NA coding downstream 145570 43258520 ~ 43266899 (+)
AMCG00009635 fam50a coding downstream 154977 43267927 ~ 43273372 (+)
AMCG00009640 NA coding downstream 202678 43315628 ~ 43318501 (+)
G58148 NA non-coding upstream 95429 43006601 ~ 43010050 (+)
G58123 NA non-coding upstream 166605 42938007 ~ 42938874 (+)
G58008 NA non-coding upstream 469026 42629539 ~ 42636453 (+)
G57987 NA non-coding upstream 627367 42477715 ~ 42478112 (+)
G57981 NA non-coding upstream 636877 42468308 ~ 42468602 (+)
G58178 NA non-coding downstream 99760 43212710 ~ 43213028 (+)
G58195 NA non-coding downstream 136453 43249403 ~ 43249641 (+)
G58215 NA non-coding downstream 196910 43309860 ~ 43311062 (+)
G58214 dedd,LOC108411641,LOC107758014,LOC107699191,LOC107603111 non-coding downstream 205966 43318916 ~ 43324579 (+)
G58291 NA non-coding downstream 565401 43678351 ~ 43680953 (+)
G57830 NA other upstream 1027238 42036018 ~ 42078241 (+)
AMCG00009563 camk2n1a,camk2n2,LOC107659987,LOC108443638,LOC107557885,LOC103024774 other upstream 1506355 41596229 ~ 41599124 (+)
G57604 NA other upstream 2110820 40990802 ~ 40994659 (+)
AMCG00009516 NA other upstream 3000427 40086474 ~ 40105052 (+)
G57430 NA other upstream 3156279 39948006 ~ 39949200 (+)
AMCG00009647 NA other downstream 324040 43436990 ~ 43444420 (+)
G58324 NA other downstream 820002 43932952 ~ 43935762 (+)
G58522 NA other downstream 1273547 44386497 ~ 44407568 (+)
AMCG00009694 LOC103385381 other downstream 1448827 44561777 ~ 44570531 (+)
AMCG00009700 plxna3,LOC102792317,LOC102288896,LOC101485239,LOC106572068,LOC106566493 other downstream 1471612 44584562 ~ 44603609 (+)

Expression


Co-expression Network