AMCG00009704 (plxna3,LOC107743094,LOC107601745)


Basic Information

Item Value
gene id AMCG00009704
gene name plxna3,LOC107743094,LOC107601745
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 44653851 ~ 44654614 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00009704
TTCGCGGAACTGCAGACGGACATCCAGGAGTTGACCAACGACATGGATGGCGTGAAGATCCCGTTCCTGGAGTACCGCACCTACACCCTGCGCGTCATGTTCCCCGGCATCGAGGAGCACCCAGTCCTCAAGGAGCTGGACTCTCCGGCCAATATGGAGAAGGCCCTGCGCCTGTTCAGCCACCTGCTGCACAACAAGGTGTTCCTGCTGACCTTCATCCACACGCTGGAGGCGCAGCGCTCCTTCTCCATGCGCGACCGCGGCAACGTGGCCTCGCTGCTGATGGCGGCGCTGCAGGGCCGCATGGAGTACGCCACCGTGGTGCTGAAGCAGCTGCTGGCCGACCTCATCGAGAAGAACCTGGAGAACCGCAACCACCCCAAGCTGCTGCTGCGCCGGACCGAGTCGGTGGCTGAGAAGATGCTGACCAACTGGTTCACCTTCCTGCTGCACAGATTCCTCAAGGTGAGACCCTCGGCCTCCACACCGCTGCGCGCAATAACCAATGGGCTAACGGCAGTGGATTAA

Function

symbol description
plxna3 Enables identical protein binding activity. Acts upstream of or within several processes, including axonogenesis; branching morphogenesis of a nerve; and embryonic skeletal joint morphogenesis. Located in membrane. Is expressed in fin; nervous system; otic vesicle; and post-vent region. Orthologous to human PLXNA3 (plexin A3).

NR:

description
PREDICTED: plexin-A3 isoform X2

GO:

id name namespace
GO:0048755 branching morphogenesis of a nerve biological_process
GO:0060272 embryonic skeletal joint morphogenesis biological_process
GO:0008045 motor neuron axon guidance biological_process
GO:0048675 axon extension biological_process
GO:0048696 regulation of collateral sprouting in absence of injury biological_process
GO:0007165 signal transduction biological_process
GO:0005886 plasma membrane cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00009704 True 528 mRNA 0.62 3 44653851 44654614

Neighbor

gene id symbol gene type direction distance location
AMCG00009691 NA coding downstream 299098 44346470 ~ 44354753 (-)
AMCG00009692 NA coding downstream 311560 44339063 ~ 44342291 (-)
AMCG00009693 NA coding downstream 325497 44323985 ~ 44328354 (-)
AMCG00009690 gdi1,LOC105013583,LOC106567106,LOC106572620 coding downstream 360733 44284878 ~ 44293118 (-)
AMCG00009683 NA coding downstream 389729 44256415 ~ 44264122 (-)
AMCG00009705 NA coding upstream 1430 44656044 ~ 44657724 (-)
AMCG00009710 NA coding upstream 28050 44682664 ~ 44693533 (-)
AMCG00009713 LOC107601746 coding upstream 134516 44789130 ~ 44808487 (-)
AMCG00009718 LOC106566500,LOC105009055,LOC102795717,LOC107584920,LOC107735484 coding upstream 267475 44922089 ~ 44927038 (-)
AMCG00009717 NA coding upstream 315348 44969962 ~ 44976755 (-)
G58585 NA non-coding downstream 110674 44542943 ~ 44543177 (-)
G58548 flna,LOC107699576 non-coding downstream 127612 44481052 ~ 44526239 (-)
G58511 NA non-coding downstream 328278 44325157 ~ 44325573 (-)
G58459 NA non-coding downstream 532784 44115650 ~ 44121067 (-)
G58457 NA non-coding downstream 543568 44109969 ~ 44110283 (-)
G58605 NA non-coding upstream 3802 44658416 ~ 44659098 (-)
G58611 NA non-coding upstream 7267 44661881 ~ 44662333 (-)
G58612 NA non-coding upstream 10124 44664738 ~ 44664945 (-)
G58613 NA non-coding upstream 10508 44665122 ~ 44665331 (-)
G58654 NA non-coding upstream 130990 44785604 ~ 44786772 (-)
G58589 NA other downstream 87017 44566069 ~ 44566834 (-)
G58584 NA other downstream 111042 44541894 ~ 44542809 (-)
AMCG00009697 NA other downstream 141602 44501787 ~ 44512249 (-)
AMCG00009672 NA other downstream 658197 43989511 ~ 43995654 (-)
G58333 NA other downstream 708554 43482421 ~ 43945297 (-)
G58653 NA other upstream 128304 44782918 ~ 44785134 (-)
AMCG00009739 NA other upstream 514327 45168941 ~ 45230457 (-)
AMCG00009742 NA other upstream 597023 45251637 ~ 45277597 (-)
AMCG00009748 NA other upstream 666143 45320757 ~ 45326055 (-)
AMCG00009755 NA other upstream 804129 45458743 ~ 45465377 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_036224 plxna3 coding NC_007119.7 CM002892.2 9222684 ~ 9570511 (-)