G53223


Basic Information

Item Value
gene id G53223
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 17527219 ~ 17527433 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU66601
CCTCTCTTTACCACTCTTCCTCCCTCTACACCTCTCTTCTCTCAGCGTCTCCTCCTGCCATACCCGCGGGGGTCAGACACACCCTGTGACTCTTCCTTGCCATTGTGCTGGGCGATGCGGTACAGTGTGTTTGCCAGGTTGTGCAGTTGACAGGTGCCCAACTGGCACCCCCGCCCACCACCCCCAGACTGAGAGCGTCGCCTCCGGGAAAGAGA

Function

NR:

description
PREDICTED: kinesin heavy chain isoform 5A-like

GO: NA

KEGG:

id description
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption
ko04975 Fat digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU66601 True 215 lncRNA 0.60 1 17527219 17527433

Neighbor

gene id symbol gene type direction distance location
AMCG00008996 NA coding upstream 74002 17423446 ~ 17453217 (+)
AMCG00008993 NA coding upstream 365678 17161085 ~ 17161541 (+)
AMCG00008990 NA coding upstream 684501 16799599 ~ 16842718 (+)
AMCG00008991 NA coding upstream 728690 16798074 ~ 16798529 (+)
AMCG00008984 NA coding upstream 855789 16659992 ~ 16671430 (+)
AMCG00009003 NA coding downstream 261087 17788520 ~ 17796297 (+)
AMCG00009005 NA coding downstream 292167 17819600 ~ 17829383 (+)
AMCG00009004 med25,LOC106601541,LOC106601511 coding downstream 304510 17831943 ~ 17845668 (+)
AMCG00009002 LOC103358380 coding downstream 336376 17863809 ~ 17868958 (+)
AMCG00009007 NA coding downstream 371645 17899078 ~ 17915696 (+)
G53180 NA non-coding upstream 205997 17320970 ~ 17321222 (+)
G53178 NA non-coding upstream 208709 17318291 ~ 17318510 (+)
G53176 NA non-coding upstream 215551 17311468 ~ 17311668 (+)
G53157 NA non-coding upstream 414211 17112116 ~ 17113008 (+)
G53155 NA non-coding upstream 417535 17109079 ~ 17109684 (+)
G53224 NA non-coding downstream 45 17527478 ~ 17613616 (+)
G53254 NA non-coding downstream 99465 17626898 ~ 17628315 (+)
G53255 NA non-coding downstream 110728 17638161 ~ 17638374 (+)
G53290 NA non-coding downstream 147181 17674614 ~ 17685760 (+)
G53288 NA non-coding downstream 205181 17732614 ~ 17734816 (+)
AMCG00008995 NA other upstream 183543 17330892 ~ 17343676 (+)
AMCG00008986 shank1,LOC108427331 other upstream 776421 16746687 ~ 16750798 (+)
AMCG00008988 shank1,LOC108427331,LOC103392692 other upstream 789720 16731389 ~ 16737499 (+)
AMCG00008985 NA other upstream 800924 16679825 ~ 16726295 (+)
G53028 NA other upstream 853677 16672503 ~ 16673542 (+)
G53298 mybpc2 other downstream 201933 17729366 ~ 17730660 (+)
AMCG00009009 NA other downstream 390115 17917548 ~ 17920592 (+)
G53520 NA other downstream 1023339 18550772 ~ 18553960 (+)
AMCG00009022 dnajc19,LOC107727073 other downstream 2000464 19527897 ~ 19547507 (+)
AMCG00009033 nlgn1,LOC103399994,LOC102210587,LOC102311540 other downstream 2849362 20376795 ~ 20396356 (+)

Expression


Co-expression Network