G54003 (LOC107575789)



Basic Information


Item Value
gene id G54003
gene name LOC107575789
gene type unknown
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 22183088 ~ 22183565 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU67499
ataaaagacacctgtccacagacgcaatcaatcaatcagattccaaactctccaccatggccaagaccaaagagctgtccaaggatgtcagggacaagattgtagacctacacaaggctggaatgggctacaagaccatcgccaagcagcttggtgacaacagttggtgcgattattcgcaaatggaagaaacacaaaaaaactgtcagtctccctcggtctggggctccatgcaagatctcacctcgtggagtttcaatgatcatgagaagggtgaggaatcagcccacacgggaggatcttgttaatgatctcaaggcagctgggaccatagtcaccaagaaaacaattggtaacacactacgccgtgaaggactgaaatcctgcagcgcccgcaaggtccccctgctcaagaaagcacatgtacaggcccgtctggagtttgccaatgaacatctgaatgattcagaggagaact

Function


NR:

description
PREDICTED: receptor-type tyrosine-protein phosphatase zeta-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU67499 True 478 TUCP 0.49 1 22183088 22183565
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00009041 tbl1xr1,LOC103376174,LOC106584305 coding downstream 149981 21869612 ~ 22033107 (-)
AMCG00009039 NA coding downstream 746666 21295543 ~ 21436422 (-)
AMCG00009040 NA coding downstream 887619 21294324 ~ 21295469 (-)
AMCG00009036 NA coding downstream 1440756 20741493 ~ 20742332 (-)
AMCG00009037 NA coding downstream 1441602 20741291 ~ 20741486 (-)
AMCG00009044 LOC107578566 coding upstream 291789 22475354 ~ 22486801 (-)
AMCG00009047 NA coding upstream 327627 22511192 ~ 22529264 (-)
AMCG00009046 xrn1,LOC107563287,LOC107710613 coding upstream 357182 22540747 ~ 22556988 (-)
AMCG00009045 atr,LOC107677746,LOC107700496 coding upstream 375964 22559529 ~ 22606887 (-)
AMCG00009048 pcolce2,pcolce2b,LOC107588030 coding upstream 465129 22648694 ~ 22666185 (-)
G53999 NA non-coding downstream 35524 22147308 ~ 22147564 (-)
G53955 NA non-coding downstream 374477 21808284 ~ 21808611 (-)
G53953 NA non-coding downstream 411097 21771646 ~ 21771991 (-)
G53918 NA non-coding downstream 889187 21292475 ~ 21293901 (-)
G53916 NA non-coding downstream 907747 21274730 ~ 21275341 (-)
G54008 NA non-coding upstream 120043 22303608 ~ 22303893 (-)
G54078 NA non-coding upstream 445766 22629331 ~ 22630508 (-)
G54124 NA non-coding upstream 609447 22793012 ~ 22826612 (-)
G54139 NA non-coding upstream 792896 22976461 ~ 22976682 (-)
G54161 NA non-coding upstream 955890 23139455 ~ 23139692 (-)
G53809 NA other downstream 1911274 20179799 ~ 20271814 (-)
AMCG00009027 NA other downstream 2120909 20061524 ~ 20062179 (-)
AMCG00009029 NA other downstream 2212812 19961027 ~ 19970276 (-)
G53355 lrrc4b,LOC107677294,LOC107556667 other downstream 4314392 17868386 ~ 17868696 (-)
AMCG00009001 NA other downstream 4436045 17724719 ~ 17747043 (-)
AMCG00009060 hltf other upstream 1641664 23825229 ~ 23863035 (-)
G54544 NA other upstream 2969701 25153266 ~ 25156338 (-)
AMCG00009100 NA other upstream 2990112 25173677 ~ 25176378 (-)
AMCG00009106 NA other upstream 3277041 25460606 ~ 25462690 (-)
AMCG00009105 NA other upstream 3346264 25529829 ~ 25531566 (-)

Expression


G54003(LOC107575789) Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G54003(LOC107575789) Expression in each Bioproject

Bar chart with 7 bars.
G54003(LOC107575789) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network