G54273


Basic Information

Item Value
gene id G54273
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 23817062 ~ 23819790 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU67824
TGCTGCAAGTTGTTGTACTTTTCGTAGTTGTAAATTTCAGTTGAACGCTCTTTAGCATTGAACTGCCCCTCAACTGCCTCCTGCAGATTCTCAATCAGTACTTCATGCTTCATTCCACTTTGTTGCAGAAGGTTGTTCACAAGCAGAAAGTGTTCAGCACTGAAGTGGATGTCCACATGTGAGTTGGCAGTGACTAACTCAATATTCTCTGGCCTCCAGAAGTCAACCTCAATGCTATTGGCCAGCTCTTTAATTATTTCAACATGATCCTGGTTTTCTGGTTTC

Function

GO: NA

KEGG:

id description
ko04972 Pancreatic secretion
ko04974 Protein digestion and absorption

RNA

RNA id representative length rna type GC content exon number start site end site
TU67824 True 285 lncRNA 0.42 3 23817062 23819790

Neighbor

gene id symbol gene type direction distance location
AMCG00009057 zic4,LOC107588037,LOC101481722,LOC102208739,LOC100703503,LOC107757405,LOC107557562 coding downstream 160912 23645454 ~ 23656150 (-)
AMCG00009055 si:ch73-206p6.1,LOC107557560,LOC107679633,LOC107739143,LOC108272643 coding downstream 347962 23450545 ~ 23469100 (-)
AMCG00009054 plod2 coding downstream 414570 23378607 ~ 23402492 (-)
AMCG00009051 NA coding downstream 999069 22721882 ~ 22817993 (-)
AMCG00009048 pcolce2,pcolce2b,LOC107588030 coding downstream 1150877 22648694 ~ 22666185 (-)
AMCG00009062 nck1b,nck1,LOC107734380,LOC107683484,LOC107713805,LOC107588047 coding upstream 74304 23894094 ~ 23914458 (-)
AMCG00009063 slc35g2,slc35g2b,LOC108263162,LOC107588046,LOC107687509,LOC103026733 coding upstream 140809 23960599 ~ 23961852 (-)
AMCG00009065 pccb,LOC106574468,LOC107688488,LOC107709888 coding upstream 231960 24051750 ~ 24062621 (-)
AMCG00009067 ppp2r3a coding upstream 256609 24076399 ~ 24088941 (-)
AMCG00009068 NA coding upstream 287415 24107205 ~ 24111579 (-)
G54179 NA non-coding downstream 514377 23302454 ~ 23302685 (-)
G54168 NA non-coding downstream 625567 23180327 ~ 23191495 (-)
G54167 LOC103376870 non-coding downstream 647233 23169439 ~ 23169829 (-)
G54161 NA non-coding downstream 677370 23139455 ~ 23139692 (-)
G54139 NA non-coding downstream 840380 22976461 ~ 22976682 (-)
G54363 NA non-coding upstream 458093 24277883 ~ 24278536 (-)
G54408 NA non-coding upstream 808049 24627839 ~ 24710773 (-)
G54415 NA non-coding upstream 844515 24664305 ~ 24666234 (-)
G54447 NA non-coding upstream 968605 24788395 ~ 24791263 (-)
G54450 NA non-coding upstream 993763 24813553 ~ 24847829 (-)
G54003 LOC107575789 other downstream 1633497 22183088 ~ 22183565 (-)
G53809 NA other downstream 3545248 20179799 ~ 20271814 (-)
AMCG00009027 NA other downstream 3754883 20061524 ~ 20062179 (-)
AMCG00009029 NA other downstream 3846786 19961027 ~ 19970276 (-)
G53355 lrrc4b,LOC107677294,LOC107556667 other downstream 5948366 17868386 ~ 17868696 (-)
AMCG00009060 hltf other upstream 5439 23825229 ~ 23863035 (-)
G54544 NA other upstream 1333476 25153266 ~ 25156338 (-)
AMCG00009100 NA other upstream 1353887 25173677 ~ 25176378 (-)
AMCG00009106 NA other upstream 1640816 25460606 ~ 25462690 (-)
AMCG00009105 NA other upstream 1710039 25529829 ~ 25531566 (-)

Expression


Co-expression Network