G57287



Basic Information


Item Value
gene id G57287
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 39306488 ~ 39306774 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU71627
CATTAAGAAGGAGTAGCCCATCCATAGGCTGCGCCACCCTCTGGGGCACATGGGGATGATCGAGTCCTGGCTGTGGAATGCCACTGCGACAGCGGACGCGTCGCACACCACGCATCTGCTGATGTAGCGCTGAATCTCCTCGCCCGACACCGGCATCATGGGAATGGGAGCCGTGGTGGACAGCCAGTAGGATTTATCATTTCGACTGGCGTAGTTACACACTCCGTTCATGTTGCAGAACGTGAAGGGCATCGTGCTGAACATTGGCAAACAAGACCCTGCGAGAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU71627 True 287 lncRNA 0.57 1 39306488 39306774
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00009479 NA coding upstream 3703 39277091 ~ 39302785 (+)
AMCG00009477 NA coding upstream 151394 39133854 ~ 39155094 (+)
AMCG00009474 NA coding upstream 405951 38869487 ~ 38900537 (+)
AMCG00009473 NA coding upstream 463177 38841956 ~ 38843311 (+)
AMCG00009469 NA coding upstream 488822 38814035 ~ 38817666 (+)
AMCG00009484 NA coding downstream 71475 39378249 ~ 39393565 (+)
AMCG00009483 NA coding downstream 86795 39393569 ~ 39401188 (+)
AMCG00009482 NA coding downstream 97555 39404329 ~ 39405173 (+)
AMCG00009481 NA coding downstream 102718 39409492 ~ 39415596 (+)
AMCG00009489 NA coding downstream 176387 39483161 ~ 39503369 (+)
G57286 NA non-coding upstream 258 39303337 ~ 39306230 (+)
G57175 NA non-coding upstream 471543 38757380 ~ 38834945 (+)
G57164 NA non-coding upstream 673137 38633097 ~ 38633351 (+)
G57161 NA non-coding upstream 678353 38627919 ~ 38628135 (+)
G57036 NA non-coding upstream 1026009 38202794 ~ 38280479 (+)
G57329 NA non-coding downstream 152624 39459398 ~ 39459676 (+)
G57378 NA non-coding downstream 499809 39806583 ~ 39806928 (+)
G57401 NA non-coding downstream 568107 39874881 ~ 39875170 (+)
G57428 NA non-coding downstream 634448 39941222 ~ 39943036 (+)
G57457 NA non-coding downstream 723772 40030546 ~ 40033333 (+)
G57105 NA other upstream 848896 38442255 ~ 38457592 (+)
AMCG00009428 NA other upstream 1689792 37608305 ~ 37616696 (+)
AMCG00009429 NA other upstream 1701364 37530822 ~ 37605124 (+)
AMCG00009415 wwtr1,LOC107588432,LOC107732229,LOC107662944,LOC107572084 other upstream 1842983 37422017 ~ 37463505 (+)
AMCG00009405 pfn2,LOC105899220,LOC106598797,LOC105028925 other upstream 1938817 37348108 ~ 37367671 (+)
AMCG00009480 sst1.1,LOC106579799,LOC105009822,LOC107586749,LOC103023622,LOC107582287 other downstream 128126 39434900 ~ 39437017 (+)
G57430 NA other downstream 641232 39948006 ~ 39949200 (+)
AMCG00009516 NA other downstream 779700 40086474 ~ 40105052 (+)
G57604 NA other downstream 1684028 40990802 ~ 40994659 (+)
AMCG00009563 camk2n1a,camk2n2,LOC107659987,LOC108443638,LOC107557885,LOC103024774 other downstream 2289455 41596229 ~ 41599124 (+)

Expression


G57287 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G57287 Expression in each Bioproject

Bar chart with 4 bars.
G57287 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network