G57948


Basic Information

Item Value
gene id G57948
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030126.1
NCBI id CM030126.1
chromosome length 46242406
location 42427842 ~ 42428048 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU72449
AAATGCACCAGGTTGAACCTACTGTCCCATAGGTTTTTTAGTGCCATCGAGGAGTTTTCTGATAGGTTGTTGCCCCCCAACAGGAGACCAGTCAGAGTTTTGCTGCTCGCTACCACCCTCTGCCACTGAGCTTGCACGTGACCAGCCTGCAGGGAAACCAAGCACACAATGCTGAAATCTGCAGACTGGAGAGAAGGCTAATCAAGA

Function

GO:

id name namespace
GO:0051674 localization of cell biological_process
GO:0050900 leukocyte migration biological_process
GO:0016477 cell migration biological_process
GO:0002376 immune system process biological_process
GO:0048870 cell motility biological_process
GO:0040011 locomotion biological_process
GO:0030595 leukocyte chemotaxis biological_process
GO:0060326 cell chemotaxis biological_process

KEGG:

id description
ko04650 Natural killer cell mediated cytotoxicity
ko04660 T cell receptor signaling pathway
ko04658 Th1 and Th2 cell differentiation
ko04659 Th17 cell differentiation
ko05340 Primary immunodeficiency

RNA

RNA id representative length rna type GC content exon number start site end site
TU72449 True 207 lncRNA 0.51 1 42427842 42428048

Neighbor

gene id symbol gene type direction distance location
AMCG00009600 gpr173,LOC108265110,LOC107549979,LOC105898994,LOC107731146,LOC107678674,LOC107549585,LOC107745752 coding upstream 12297 42414205 ~ 42415545 (+)
AMCG00009594 NA coding upstream 28511 42385499 ~ 42399331 (+)
AMCG00009591 NA coding upstream 129752 42290154 ~ 42298090 (+)
AMCG00009593 NA coding upstream 147413 42275999 ~ 42280429 (+)
AMCG00009586 NA coding upstream 156645 42266822 ~ 42271197 (+)
AMCG00009595 NA coding downstream 18909 42446957 ~ 42463730 (+)
AMCG00009604 NA coding downstream 60389 42488437 ~ 42489969 (+)
AMCG00009606 NA coding downstream 103669 42531717 ~ 42546719 (+)
AMCG00009605 LOC107602861 coding downstream 138572 42566620 ~ 42570939 (+)
AMCG00009608 NA coding downstream 168045 42596093 ~ 42599734 (+)
G57947 NA non-coding upstream 7019 42418590 ~ 42420823 (+)
G57946 NA non-coding upstream 9337 42418141 ~ 42418505 (+)
G57945 NA non-coding upstream 9733 42415590 ~ 42418109 (+)
G57940 NA non-coding upstream 25390 42402235 ~ 42402452 (+)
G57843 NA non-coding upstream 339697 42085279 ~ 42088145 (+)
G57964 NA non-coding downstream 4829 42432877 ~ 42435152 (+)
G57981 NA non-coding downstream 40260 42468308 ~ 42468602 (+)
G57987 NA non-coding downstream 49667 42477715 ~ 42478112 (+)
G58008 NA non-coding downstream 201491 42629539 ~ 42636453 (+)
G58123 NA non-coding downstream 509959 42938007 ~ 42938874 (+)
G57830 NA other upstream 349601 42036018 ~ 42078241 (+)
AMCG00009563 camk2n1a,camk2n2,LOC107659987,LOC108443638,LOC107557885,LOC103024774 other upstream 828718 41596229 ~ 41599124 (+)
G57604 NA other upstream 1433183 40990802 ~ 40994659 (+)
AMCG00009516 NA other upstream 2322790 40086474 ~ 40105052 (+)
G57430 NA other upstream 2478642 39948006 ~ 39949200 (+)
AMCG00009647 NA other downstream 1008942 43436990 ~ 43444420 (+)
G58324 NA other downstream 1504904 43932952 ~ 43935762 (+)
G58522 NA other downstream 1958449 44386497 ~ 44407568 (+)
AMCG00009694 LOC103385381 other downstream 2133729 44561777 ~ 44570531 (+)
AMCG00009700 plxna3,LOC102792317,LOC102288896,LOC101485239,LOC106572068,LOC106566493 other downstream 2156514 44584562 ~ 44603609 (+)

Expression


Co-expression Network