AMCG00009936 (s100z,LOC107663035,LOC107720888)


Basic Information

Item Value
gene id AMCG00009936
gene name s100z,LOC107663035,LOC107720888
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030129.1
NCBI id CM030129.1
chromosome length 41163702
location 6180403 ~ 6185389 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00009936
ATGACGGAAGTGGAGGCAGGACTCATGTGGACTCTCAGGAATTCTAACAGGCTCACCTTCCCCACCATCATGCCGAGCAAACTGGAAGGTGCCATGGACGCCCTCATCAATGTCTTCCACAACTACTCCGGCAACGAGGGCGACAAGTACAAACTCAACAAAGGCGAGCTGAAGCAGCTGCTCACCAGCGAGCTCACCGACTTCCTCACGTCTCAAAAGGATCCAATGCTGGTGGACAAAATCATGAACGACTTGGATTCCAACAAAGACAACGAGGTGGATTTCAATGAGTTTGTGGTGCTGGTTGCTGCTCTGACAGTGGCTTGCAACGACTTCTTTGAGGAACAACAGAAGAAGAAGGCAAAATAA

Function

symbol description
s100z Predicted to enable calcium ion binding activity and calcium-dependent protein binding activity. Is expressed in several structures, including digestive system; heart; integument; renal system; and sensory system. Orthologous to human S100Z (S100 calcium binding protein Z).

NR:

description
PREDICTED: protein S100-Z-like isoform X1

GO:

id name namespace
GO:0005509 calcium ion binding molecular_function

KEGG:

id description
K23772 S100Z; protein S100-Z

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00009936 True 369 mRNA 0.50 3 6180403 6185389

Neighbor

gene id symbol gene type direction distance location
AMCG00009928 NA coding upstream 25545 6150018 ~ 6154858 (+)
AMCG00009930 NA coding upstream 31012 6112296 ~ 6149391 (+)
AMCG00009926 NA coding upstream 181811 5986267 ~ 5998592 (+)
AMCG00009922 NA coding upstream 240313 5933021 ~ 5940090 (+)
AMCG00009923 ube2r2 coding upstream 285426 5890280 ~ 5894977 (+)
AMCG00009934 NA coding downstream 40147 6225536 ~ 6241567 (+)
AMCG00009935 pde8b,LOC106568179,LOC106563036,LOC106928739 coding downstream 64511 6249900 ~ 6284991 (+)
AMCG00009940 scamp1,LOC107599399 coding downstream 344675 6530064 ~ 6538910 (+)
AMCG00009945 bhmt,LOC105015174 coding downstream 480301 6665690 ~ 6670486 (+)
AMCG00009949 NA coding downstream 499378 6684767 ~ 6685849 (+)
G76555 NA non-coding upstream 12095 6167611 ~ 6168308 (+)
G76550 NA non-coding upstream 13788 6161456 ~ 6166615 (+)
G76486 NA non-coding upstream 229583 5947878 ~ 5950820 (+)
G76484 NA non-coding upstream 234350 5945706 ~ 5946053 (+)
G76460 NA non-coding upstream 279421 5897310 ~ 5900982 (+)
G76658 NA non-coding downstream 556543 6741932 ~ 6742239 (+)
G76659 NA non-coding downstream 569132 6754521 ~ 6754936 (+)
G76663 NA non-coding downstream 605377 6790766 ~ 6792207 (+)
G76770 NA non-coding downstream 990090 7175479 ~ 7231357 (+)
G76799 NA non-coding downstream 1085446 7270835 ~ 7271745 (+)
AMCG00009929 sv2c,LOC107755746,LOC107748435,LOC107565680 other upstream 94597 6059242 ~ 6085806 (+)
AMCG00009915 NA other upstream 411351 5766337 ~ 5769052 (+)
AMCG00009897 NA other upstream 932222 5232632 ~ 5248181 (+)
AMCG00009898 tmem167a other upstream 1259519 4910970 ~ 4920884 (+)
AMCG00009863 NA other upstream 3411895 2752260 ~ 2768508 (+)
AMCG00009959 NA other downstream 857208 7042597 ~ 7062734 (+)
AMCG00010021 hdhd2,ier3ip1,LOC107743237,LOC107738843,LOC102780036,LOC106633120,LOC103397450,LOC106527492 other downstream 4117537 10302926 ~ 10313486 (+)
G77423 NA other downstream 4964237 11149626 ~ 11155469 (+)
AMCG00010041 NA other downstream 5104514 11289903 ~ 11389245 (+)
G77541 NA other downstream 5515317 11700706 ~ 11701081 (+)

Expression


Co-expression Network