AMCG00010425 (rfk)


Basic Information

Item Value
gene id AMCG00010425
gene name rfk
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030129.1
NCBI id CM030129.1
chromosome length 41163702
location 29315300 ~ 29317556 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00010425
ATGAAGAGCCTCCCGTATTTCTGCAGAGGAGAGGTGGTCCGTGGATTTGGCCGGGGCAGTAAAGAGCTCGGGATCCCCACAGCTAATTTCCCAGACTCTGTGGTTGACAATTTGCCAGCTGATATCTGTACTGGAATTTATTATGGCTGGGCCTGTGTCGGCACTGGAGACGTACATCGAATGGTGATGAGTATCGGCTGGAACCCTTACTACAAGAATACTAAGAAATCAATGGAAACACACATTATCCACACATACAAAGAAGATTTTTATGGAGAAGTTCTCAGTGTAGTTGTTGTTGGCTACGTCCGTCCCGAGAAGAGCTTTGACTCATTAGATTCCCTCATTGCAGCAATTAACAATGATATTGAAGAGGCAAAAAGGAGGCTAGATTTACCTGAGCACAACAAATTGAGAGAAGACAATTTTTTCAGGACTTCAGCAAACCAAATAATGAATGGGCATTAA

Function

symbol description
rfk Predicted to enable riboflavin kinase activity. Predicted to be involved in FMN biosynthetic process and riboflavin metabolic process. Predicted to act upstream of or within riboflavin biosynthetic process. Predicted to be active in mitochondrion. Orthologous to human RFK (riboflavin kinase).

NR:

description
PREDICTED: riboflavin kinase isoform X2

GO:

id name namespace
GO:0016310 phosphorylation biological_process
GO:0009231 riboflavin biosynthetic process biological_process
GO:0008531 riboflavin kinase activity molecular_function

KEGG:

id description
K00861 RFK, FMN1; riboflavin kinase

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00010425 True 468 mRNA 0.44 4 29315300 29317556

Neighbor

gene id symbol gene type direction distance location
AMCG00010422 NA coding upstream 31710 29273211 ~ 29283590 (+)
AMCG00010420 NA coding upstream 64095 29249452 ~ 29251205 (+)
AMCG00010421 NA coding upstream 86317 29223316 ~ 29228983 (+)
AMCG00010423 NA coding upstream 207954 29095337 ~ 29107346 (+)
AMCG00010424 gnaq,LOC106523804,LOC104920278,LOC103361005,LOC103398708,LOC103397278 coding upstream 255260 29048186 ~ 29060040 (+)
AMCG00010433 NA coding downstream 192086 29509642 ~ 29513418 (+)
AMCG00010432 carnmt1,LOC107673371,LOC107599972 coding downstream 198203 29515759 ~ 29524516 (+)
AMCG00010434 NA coding downstream 210228 29527784 ~ 29551538 (+)
AMCG00010437 NA coding downstream 481684 29799240 ~ 29814090 (+)
AMCG00010441 NA coding downstream 531839 29849395 ~ 29864398 (+)
G80567 NA non-coding upstream 11750 29298158 ~ 29303550 (+)
G80521 NA non-coding upstream 197242 29115832 ~ 29118058 (+)
G80519 NA non-coding upstream 205281 29109197 ~ 29110019 (+)
G80490 NA non-coding upstream 250927 29061784 ~ 29064373 (+)
G80491 NA non-coding upstream 291827 28956272 ~ 29023473 (+)
G80580 pcsk5,LOC106580081,LOC107548272,LOC107723238 non-coding downstream 34598 29352154 ~ 29357030 (+)
G80595 NA non-coding downstream 125554 29443110 ~ 29457978 (+)
G80599 NA non-coding downstream 165735 29483291 ~ 29484341 (+)
G80652 NA non-coding downstream 453871 29771427 ~ 29775799 (+)
G80663 NA non-coding downstream 541217 29858773 ~ 29860382 (+)
AMCG00010407 NA other upstream 1049857 28242989 ~ 28265443 (+)
G80326 NA other upstream 1408471 27906497 ~ 27906829 (+)
AMCG00010393 isca1,LOC107662049 other upstream 1440369 27869439 ~ 27874931 (+)
G80249 NA other upstream 1758293 27556415 ~ 27557007 (+)
AMCG00010369 snx30,LOC107569385,LOC106591923 other upstream 2912280 26380467 ~ 26403020 (+)
AMCG00010431 NA other downstream 177007 29494563 ~ 29503523 (+)
AMCG00010467 NA other downstream 1448781 30766337 ~ 30817603 (+)
AMCG00010497 dcp2,LOC107568646,LOC104944318 other downstream 3156477 32474033 ~ 32530266 (+)
AMCG00010529 NA other downstream 4586259 33903815 ~ 33938237 (+)
G81496 NA other downstream 5383882 34701438 ~ 34707394 (+)

Expression


Co-expression Network