AMCG00010448 (abhd17b,LOC103022021,LOC107599913,LOC106580059)


Basic Information

Item Value
gene id AMCG00010448
gene name abhd17b,LOC103022021,LOC107599913,LOC106580059
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030129.1
NCBI id CM030129.1
chromosome length 41163702
location 29982190 ~ 29983125 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00010448
TATGGAATCCGTCCTGAAAACGTGATCATCTATGGCCAAAGTATAGGTACTGTCCCATCTGTGGACCTTGCTGCGCGATACGAGAGCGCTGCCGTCATTCTCCACTCTCCCCTGACATCAGGAATGCGTGTGGCCTTCCCAGACACTAAGAAGACTTACTGCTTTGACGCATTTCCAAATATTGACAAAATCTCCAAGATCACGTCTCCAGTGTTGATCATTCATGGGACAGAAGATGAAGTGATAGACTTTTCCCATGGCCTGGCTCTGTACGAGCGCTGCCAGAGACCTGTGGAGCCGCTGTGGGTGGAAGGGGCCGGTCACAATGACGTGGAACTGTACGGACAGTACCTAGAGAGATTAAAACAGTTTGTCGCTCACGAGCTGGTCAATTTG

Function

symbol description
abhd17b Predicted to enable palmitoyl-(protein) hydrolase activity. Predicted to be involved in protein depalmitoylation and regulation of postsynapse organization. Predicted to be active in endosome membrane and plasma membrane. Orthologous to human ABHD17B (abhydrolase domain containing 17B, depalmitoylase).

NR:

description
PREDICTED: protein ABHD17B

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00010448 True 396 mRNA 0.50 2 29982190 29983125

Neighbor

gene id symbol gene type direction distance location
AMCG00010440 NA coding upstream 56107 29914593 ~ 29926083 (+)
AMCG00010441 NA coding upstream 117792 29849395 ~ 29864398 (+)
AMCG00010437 NA coding upstream 168100 29799240 ~ 29814090 (+)
AMCG00010434 NA coding upstream 430652 29527784 ~ 29551538 (+)
AMCG00010432 carnmt1,LOC107673371,LOC107599972 coding upstream 457674 29515759 ~ 29524516 (+)
AMCG00010447 NA coding downstream 8807 29991932 ~ 30021803 (+)
AMCG00010449 LOC107393780,LOC105014492 coding downstream 203811 30186936 ~ 30208135 (+)
AMCG00010446 trpm3,LOC108434489,LOC108255677 coding downstream 242566 30225691 ~ 30253139 (+)
AMCG00010445 NA coding downstream 281598 30264723 ~ 30271663 (+)
AMCG00010450 LOC106943757 coding downstream 348868 30331993 ~ 30344815 (+)
G80663 NA non-coding upstream 121808 29858773 ~ 29860382 (+)
G80652 NA non-coding upstream 206391 29771427 ~ 29775799 (+)
G80599 NA non-coding upstream 497849 29483291 ~ 29484341 (+)
G80595 NA non-coding upstream 524212 29443110 ~ 29457978 (+)
G80580 pcsk5,LOC106580081,LOC107548272,LOC107723238 non-coding upstream 625160 29352154 ~ 29357030 (+)
G80746 NA non-coding downstream 323360 30306485 ~ 30307387 (+)
G80830 NA non-coding downstream 534148 30517273 ~ 30519628 (+)
G80969 NA non-coding downstream 1063601 31046726 ~ 31070527 (+)
G80988 NA non-coding downstream 1123935 31107060 ~ 31107603 (+)
G80989 NA non-coding downstream 1126643 31109768 ~ 31110142 (+)
AMCG00010431 NA other upstream 478667 29494563 ~ 29503523 (+)
AMCG00010407 NA other upstream 1716747 28242989 ~ 28265443 (+)
G80326 NA other upstream 2075361 27906497 ~ 27906829 (+)
AMCG00010393 isca1,LOC107662049 other upstream 2107259 27869439 ~ 27874931 (+)
G80249 NA other upstream 2425183 27556415 ~ 27557007 (+)
AMCG00010467 NA other downstream 783212 30766337 ~ 30817603 (+)
AMCG00010497 dcp2,LOC107568646,LOC104944318 other downstream 2490908 32474033 ~ 32530266 (+)
AMCG00010529 NA other downstream 3920690 33903815 ~ 33938237 (+)
G81496 NA other downstream 4718313 34701438 ~ 34707394 (+)
AMCG00010545 megf10 other downstream 4773394 34756519 ~ 34845876 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_036364 abhd17ab coding NC_007119.7 CM002892.2 19232238 ~ 19246342 (-)