AMCG00010566 (ror2,LOC102784735,LOC107720387)


Basic Information

Item Value
gene id AMCG00010566
gene name ror2,LOC102784735,LOC107720387
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030129.1
NCBI id CM030129.1
chromosome length 41163702
location 35604138 ~ 35612541 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00010566
ATGGGCCTGGCGGAAGCCCAGAGCCGAGGCCTGCCAACACCTGAAGGTTACTACCTTTACTTTGTGGAACCAGTGGAGAATATCACCTTATTTCAAGGGCAAACTGCTATACTGCACTGCAAAGTGGCGGGAAACCCTTTACCGAGCATCAGATGGCTGAAGAACGACGCCCCAGTCGTCCAGGAGCAGGGCCGGATATCCATCAGGAAAACCGATCTGGGATCCAGGCTGCGCATCCAAGACTTGGACACCACGGACACTGGCTACTATCAGTGCGTGGCGACCAACAGCGTGAAGGAAATCTCTGCCACTGGAGTCCTGTATGTTAGATTTGGGCAGTCACCAACACCTGGCTCCAACTTCAATGACCAGTAA

Function

symbol description
ror2 Enables protein heterodimerization activity. Acts upstream of or within convergent extension involved in gastrulation. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Predicted to be part of receptor complex. Predicted to be integral component of plasma membrane. Is expressed in brain and female organism. Human ortholog(s) of this gene implicated in autosomal recessive Robinow syndrome; brachydactyly type B1; and cleft palate. Orthologous to human ROR2 (receptor tyrosine kinase like orphan receptor 2).

NR:

description
PREDICTED: tyrosine-protein kinase transmembrane receptor ROR2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00010566 True 375 mRNA 0.54 3 35604138 35612541

Neighbor

gene id symbol gene type direction distance location
AMCG00010564 sptlc1 coding upstream 49139 35544049 ~ 35554999 (+)
AMCG00010560 chsy3,LOC107573232,LOC107665461 coding upstream 238857 35363710 ~ 35365281 (+)
AMCG00010558 chsy3,LOC104965884 coding upstream 338752 35261967 ~ 35265386 (+)
AMCG00010559 NA coding upstream 346847 35250836 ~ 35257291 (+)
AMCG00010556 adamts19 coding upstream 353981 35216218 ~ 35250157 (+)
AMCG00010570 NA coding downstream 88120 35700661 ~ 35701496 (+)
AMCG00010569 auh,LOC107720385 coding downstream 106694 35719235 ~ 35731357 (+)
AMCG00010568 auh coding downstream 133996 35746537 ~ 35751114 (+)
AMCG00010572 diras2,LOC107560410,LOC107670053,LOC107736992,LOC107702570 coding downstream 190683 35803224 ~ 35808390 (+)
AMCG00010574 NA coding downstream 330306 35942847 ~ 35944273 (+)
G81586 NA non-coding upstream 501554 35102352 ~ 35102584 (+)
G81583 NA non-coding upstream 553526 35050405 ~ 35050612 (+)
G81582 NA non-coding upstream 564671 35039257 ~ 35039467 (+)
G81581 LOC108412713 non-coding upstream 587006 35016909 ~ 35017132 (+)
G81580 NA non-coding upstream 587804 35016075 ~ 35016334 (+)
G81675 NA non-coding downstream 49622 35662163 ~ 35666680 (+)
G81707 NA non-coding downstream 90148 35702689 ~ 35704527 (+)
G81710 NA non-coding downstream 94976 35707517 ~ 35713953 (+)
G81812 NA non-coding downstream 532297 36144838 ~ 36145081 (+)
G81814 NA non-coding downstream 535002 36147543 ~ 36148008 (+)
AMCG00010563 cdc42se2 other upstream 77914 35480800 ~ 35526224 (+)
AMCG00010562 NA other upstream 126548 35470335 ~ 35477590 (+)
G81576 NA other upstream 591445 35012315 ~ 35012693 (+)
AMCG00010545 megf10 other upstream 758262 34756519 ~ 34845876 (+)
G81496 NA other upstream 896744 34701438 ~ 34707394 (+)
AMCG00010578 NA other downstream 464572 36077113 ~ 36079892 (+)
AMCG00010585 NA other downstream 478998 36091539 ~ 36094497 (+)
G81971 NA other downstream 1617887 37230428 ~ 37251169 (+)
G81987 NA other downstream 1648783 37261324 ~ 37264049 (+)
G82192 NA other downstream 2273679 37886220 ~ 37888163 (+)

Expression


Co-expression Network