G80235


Basic Information

Item Value
gene id G80235
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030129.1
NCBI id CM030129.1
chromosome length 41163702
location 27288579 ~ 27288856 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU100068
ccataacattatgaccactgacaggtgaagtgaataacactgataatctcgttatcatggcacctgtcagtgggtgggatatattaggcagcaagtgaacattttgtcctcaaagttgatgtgttagaagcaggaaaaatgggcaagcgtaaggatctgagcgactttgacaagggccaaactgtgatggctagacgactgggtcagagcatctccaaaactgcagctctagtggggtgttcccggtctgcagtggtcagtacctatcaaaagtggtc

Function

GO: NA

KEGG:

id description
ko04913 Ovarian steroidogenesis
ko04927 Cortisol synthesis and secretion

RNA

RNA id representative length rna type GC content exon number start site end site
TU100068 True 278 lncRNA 0.47 1 27288579 27288856

Neighbor

gene id symbol gene type direction distance location
AMCG00010380 NA coding upstream 10826 27264785 ~ 27277753 (+)
AMCG00010378 NA coding upstream 366704 26917897 ~ 26921875 (+)
AMCG00010374 plppr1,LOC107653496,LOC107702599,LOC107710008,LOC107750956 coding upstream 536643 26747568 ~ 26751936 (+)
AMCG00010377 NA coding upstream 553061 26735297 ~ 26735518 (+)
AMCG00010372 NA coding upstream 650351 26622349 ~ 26638228 (+)
AMCG00010382 epha5,LOC108428864,LOC107709147,LOC107702602 coding downstream 172186 27461042 ~ 27466622 (+)
AMCG00010381 NA coding downstream 219999 27508855 ~ 27509833 (+)
AMCG00010379 epha5,LOC108428864,LOC107567057,LOC107702602 coding downstream 236664 27525520 ~ 27548008 (+)
AMCG00010385 lpar1,LOC106568607,LOC107554848,LOC106572527 coding downstream 421757 27710613 ~ 27723371 (+)
AMCG00010383 NA coding downstream 474724 27763580 ~ 27775353 (+)
G80217 NA non-coding upstream 85378 27203001 ~ 27203201 (+)
G80210 NA non-coding upstream 210075 27078289 ~ 27078504 (+)
G80208 NA non-coding upstream 371740 26916541 ~ 26916839 (+)
G80207 NA non-coding upstream 372444 26915734 ~ 26916135 (+)
G80163 NA non-coding upstream 786305 26497769 ~ 26502274 (+)
G80264 NA non-coding downstream 506654 27795510 ~ 27796290 (+)
G80331 naa35 non-coding downstream 647310 27936166 ~ 27937054 (+)
G80362 NA non-coding downstream 732618 28021474 ~ 28021684 (+)
G80392 NA non-coding downstream 917465 28206321 ~ 28207268 (+)
G80468 NA non-coding downstream 1436151 28725007 ~ 28725281 (+)
AMCG00010369 snx30,LOC107569385,LOC106591923 other upstream 885559 26380467 ~ 26403020 (+)
G80014 NA other upstream 1262276 26012484 ~ 26026303 (+)
AMCG00010366 tal2,LOC106585373,LOC106580046 other upstream 1292165 25992558 ~ 25996414 (+)
AMCG00010333 NA other upstream 2451027 24833071 ~ 24837552 (+)
AMCG00010320 LOC104946060 other upstream 3278726 23920760 ~ 24009853 (+)
G80249 NA other downstream 267559 27556415 ~ 27557007 (+)
AMCG00010393 isca1,LOC107662049 other downstream 580583 27869439 ~ 27874931 (+)
G80326 NA other downstream 617641 27906497 ~ 27906829 (+)
AMCG00010407 NA other downstream 954133 28242989 ~ 28265443 (+)
AMCG00010431 NA other downstream 2205707 29494563 ~ 29503523 (+)

Expression


Co-expression Network