G82856



Basic Information


Item Value
gene id G82856
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030129.1
NCBI id CM030129.1
chromosome length 41163702
location 40310701 ~ 40310969 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU103407
gaccacatcaaaccagaggagcttttccagatcagcaggaacacacgcacccggggacacaaatggaaattgggcttcaaggcattcaagacagaaaacaggagacacttcttcacacagagaggcgtcacaatctgaacaaactccccagcgatgtggctgaagagacaatgtgggaacattcaaaaacagactggataggatccttgatcacttagttattaatggacaccaaacgagcacgatggggcgaatgggctcctctcgac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU103407 True 269 lncRNA 0.49 1 40310701 40310969

Neighbor


gene id symbol gene type direction distance location
AMCG00010730 NA coding downstream 71815 40171351 ~ 40238886 (-)
AMCG00010724 NA coding downstream 250639 40051133 ~ 40060062 (-)
AMCG00010723 LOC107687380 coding downstream 276611 40023754 ~ 40034090 (-)
AMCG00010727 NA coding downstream 289534 40020862 ~ 40021167 (-)
AMCG00010729 NA coding downstream 292377 40018133 ~ 40018324 (-)
AMCG00010731 NA coding upstream 122676 40433645 ~ 40449457 (-)
AMCG00010733 NA coding upstream 152210 40463179 ~ 40463912 (-)
AMCG00010732 NA coding upstream 158494 40469463 ~ 40472181 (-)
AMCG00010741 NA coding upstream 290823 40601792 ~ 40634214 (-)
AMCG00010742 NA coding upstream 328573 40639542 ~ 40646066 (-)
G82855 NA non-coding downstream 1712 40308787 ~ 40308989 (-)
G82853 NA non-coding downstream 49262 40261027 ~ 40261439 (-)
G82826 NA non-coding downstream 221597 40080676 ~ 40089104 (-)
G82820 NA non-coding downstream 248152 40062126 ~ 40062549 (-)
G82782 NA non-coding downstream 448374 39861992 ~ 39862327 (-)
G82891 NA non-coding upstream 217794 40528763 ~ 40529058 (-)
G82969 NA non-coding upstream 465837 40776806 ~ 40777466 (-)
G83006 NA non-coding upstream 627494 40938463 ~ 40938861 (-)
G83010 NA non-coding upstream 628232 40939201 ~ 40939777 (-)
G83022 NA non-coding upstream 657273 40968242 ~ 40970496 (-)
AMCG00010728 NA other downstream 263122 40044198 ~ 40047579 (-)
AMCG00010726 NA other downstream 298627 39997838 ~ 40012074 (-)
G82733 slc25a46,LOC106562119,LOC106568342 other downstream 690886 39557531 ~ 39619815 (-)
AMCG00010704 NA other downstream 758652 39531323 ~ 39552049 (-)
G82607 NA other downstream 801542 39505584 ~ 39509159 (-)
G82953 NA other upstream 420501 40731470 ~ 40732497 (-)
AMCG00010753 tnpo1,LOC106531499 other upstream 623978 40934947 ~ 40942328 (-)

Expression


G82856 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G82856 Expression in each Bioproject

Bar chart with 7 bars.
G82856 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network