G76863 (vcp,LOC107602017,LOC107552546,LOC107676650,LOC107708640,LOC107681079,LOC107393925)


Basic Information

Item Value
gene id G76863
gene name vcp,LOC107602017,LOC107552546,LOC107676650,LOC107708640,LOC107681079,LOC107393925
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030129.1
NCBI id CM030129.1
chromosome length 41163702
location 7649490 ~ 7650191 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU95947
CCTTGGAAATGGGAGACTTTCTGAGGTTGGCCTTGAGGATTGCAATACGAGACTTCTCGTCGGGAAGTGGGATGTAGATAAGTTGGTCCAACCGGCCAGGTCGCAGAATCGCAGGGTCGATGATATCTGGTCTGTTTGTGGCTCCGATGATGAAGACATTCTTCTTGCTGGACATGCCGTCCATTTCTGTCAGAATCTGGTTGATAACTCTGTCAGCTGCTCCACCACCATCCCCAATGTTTCCACCACGAGCTTTAGCAATGGAGTCCAGTTCATCGAAGAACAGGACGCATGGAGCAGCTTGACGGGCGTCAAAGATCTCGCGAACATTGGCCTCCGACTCTCCAAACCACATGGTGAGGAGCTCTGGTCCCTTGATGGAGATGAAGTTAGCCTGACACTCGTTGGCAATGGCCTTGGCCAACAAAGTCTTACCACAACCAGGTGGCCCGTAGAACAGCACACCTTTGGAAGGAGTCATACCAAACTTAAGGAATTTGTCTGGATGCTCAACAGGAT

Function

symbol description
vcp Predicted to enable ATP hydrolysis activity and polyubiquitin modification-dependent protein binding activity. Acts upstream of or within chordate embryonic development; locomotory behavior; and regulation of cellular catabolic process. Predicted to be located in cytoplasm and site of double-strand break. Predicted to be part of VCP-NPL4-UFD1 AAA ATPase complex. Predicted to be active in cytosol and nucleus. Is expressed in several structures, including brain; digestive system; eye; fin bud; and trunk musculature. Human ortholog(s) of this gene implicated in several diseases, including Charcot-Marie-Tooth disease type 2Y; Paget's disease of bone; amyotrophic lateral sclerosis type 14; inclusion body myopathy with early-onset Paget disease of bone with or without frontotemporal dementia 1; and inclusion body myositis. Orthologous to human VCP (valosin containing protein).

NR:

description
PREDICTED: transitional endoplasmic reticulum ATPase-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU95947 True 519 lncRNA 0.51 2 7649490 7650191

Neighbor

gene id symbol gene type direction distance location
AMCG00009972 NA coding upstream 4547 7643535 ~ 7644943 (+)
AMCG00009970 NA coding upstream 6964 7638579 ~ 7642526 (+)
AMCG00009969 dnajb5,LOC107746810,LOC107681063,LOC107708641 coding upstream 17638 7614936 ~ 7631852 (+)
AMCG00009971 NA coding upstream 61244 7562494 ~ 7588246 (+)
AMCG00009973 NA coding upstream 96839 7531887 ~ 7552651 (+)
AMCG00009976 eef2l2,LOC108255789,LOC108414462,LOC107681082,LOC107746808,LOC107676651,LOC107552597,LOC107708638 coding downstream 24373 7674564 ~ 7688493 (+)
AMCG00009980 NA coding downstream 210960 7861151 ~ 7869890 (+)
AMCG00009979 NA coding downstream 232443 7882634 ~ 7888072 (+)
AMCG00009984 zfr,LOC107681158,LOC107746805,LOC103397483 coding downstream 353646 8003837 ~ 8029681 (+)
AMCG00009985 NA coding downstream 384432 8034623 ~ 8053793 (+)
G76859 NA non-coding upstream 1324 7615958 ~ 7648166 (+)
G76827 NA non-coding upstream 213943 7434656 ~ 7435547 (+)
G76807 NA non-coding upstream 362091 7280976 ~ 7287399 (+)
G76799 NA non-coding upstream 377745 7270835 ~ 7271745 (+)
G76770 NA non-coding upstream 418133 7175479 ~ 7231357 (+)
G76864 NA non-coding downstream 1531 7651722 ~ 7652831 (+)
G76935 NA non-coding downstream 239292 7889483 ~ 7894390 (+)
G77012 NA non-coding downstream 663925 8314116 ~ 8317675 (+)
G77028 NA non-coding downstream 788316 8438507 ~ 8438786 (+)
G77049 NA non-coding downstream 1047487 8697678 ~ 8700117 (+)
AMCG00009959 NA other upstream 586756 7042597 ~ 7062734 (+)
AMCG00009929 sv2c,LOC107755746,LOC107748435,LOC107565680 other upstream 1563684 6059242 ~ 6085806 (+)
AMCG00009915 NA other upstream 1880438 5766337 ~ 5769052 (+)
AMCG00009897 NA other upstream 2401309 5232632 ~ 5248181 (+)
AMCG00009898 tmem167a other upstream 2728606 4910970 ~ 4920884 (+)
AMCG00010021 hdhd2,ier3ip1,LOC107743237,LOC107738843,LOC102780036,LOC106633120,LOC103397450,LOC106527492 other downstream 2652735 10302926 ~ 10313486 (+)
G77423 NA other downstream 3499435 11149626 ~ 11155469 (+)
AMCG00010041 NA other downstream 3639712 11289903 ~ 11389245 (+)
G77541 NA other downstream 4050515 11700706 ~ 11701081 (+)
AMCG00010101 NA other downstream 7341728 14991919 ~ 15032181 (+)

Expression


Co-expression Network