AMCG00011087 (csmd2,LOC106957799,LOC103363662)


Basic Information

Item Value
gene id AMCG00011087
gene name csmd2,LOC106957799,LOC103363662
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 10018562 ~ 10018933 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00011087
ATGTGTAGGCCAACATCTGCTCAGAACTGCAGTCATACATTACACGGTCCCAATGGGACGATAGAAAGTCCCGGCTTCCCCTATGGTTACCCCAATTATGCCAACTGCACGTGGATTCTCATCACACAGGACCACAACAGAATACAGCTGGTGTTCCAGTCGTTTGCCTTGGAAGAGGACTTTGACATCCTCTCGGTGTATGATGGACAGCCCCAGCCGAACAACTTAAGAACAAGGTAG

Function

symbol description
csmd2 Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human CSMD2 (CUB and Sushi multiple domains 2).

NR:

description
PREDICTED: CUB and sushi domain-containing protein 2

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00011087 True 240 mRNA 0.50 2 10018562 10018933

Neighbor

gene id symbol gene type direction distance location
AMCG00011082 NA coding upstream 286119 9723810 ~ 9732443 (+)
AMCG00011079 NA coding upstream 426375 9591072 ~ 9592187 (+)
AMCG00011080 gale,LOC107583591,LOC107721820 coding upstream 436817 9575129 ~ 9581745 (+)
AMCG00011081 hmgcl,LOC106610807,LOC106578367 coding upstream 443858 9566520 ~ 9574704 (+)
AMCG00011075 NA coding upstream 461175 9551804 ~ 9557387 (+)
AMCG00011088 csmd2,LOC107712626,LOC107698986,LOC107663732,LOC107757197 coding downstream 54789 10073722 ~ 10087704 (+)
AMCG00011090 csmd2 coding downstream 120528 10139461 ~ 10192241 (+)
AMCG00011091 trappc3,LOC107653823,LOC107564495 coding downstream 479544 10498477 ~ 10503466 (+)
AMCG00011095 NA coding downstream 582547 10601480 ~ 10603114 (+)
AMCG00011093 col8a2,LOC106570550,LOC107724334,LOC107565043 coding downstream 590024 10608957 ~ 10610882 (+)
G104221 NA non-coding upstream 145672 9872653 ~ 9872890 (+)
G104204 NA non-coding upstream 271698 9693144 ~ 9746864 (+)
G104150 pabpc4,LOC107721216,LOC107659242 non-coding upstream 536888 9477567 ~ 9481674 (+)
G104147 NA non-coding upstream 542719 9474174 ~ 9475843 (+)
G104115 NA non-coding upstream 665975 9352373 ~ 9352587 (+)
G104255 NA non-coding downstream 536796 10555729 ~ 10617196 (+)
G104271 NA non-coding downstream 704617 10723550 ~ 10723890 (+)
G104307 col9a2 non-coding downstream 1353621 11372554 ~ 11377085 (+)
G104310 NA non-coding downstream 1399733 11418666 ~ 11420066 (+)
G104326 NA non-coding downstream 1513987 11532920 ~ 11593994 (+)
AMCG00011076 zbtb8b,LOC107724281,LOC107584246 other upstream 469042 9530474 ~ 9549520 (+)
G103939 yars,LOC107724337,LOC107687080,LOC107709269 other upstream 1465957 8548363 ~ 8552605 (+)
AMCG00010994 NA other upstream 2915054 7071433 ~ 7103508 (+)
AMCG00010990 pum1 other upstream 3097631 6892397 ~ 6920931 (+)
G103542 NA other upstream 3375934 6641983 ~ 6642628 (+)
AMCG00011089 csmd2 other downstream 184684 10203617 ~ 10271863 (+)
G104273 NA other downstream 799755 10818688 ~ 10819423 (+)
AMCG00011110 zn706,LOC103364770,LOC104931588,LOC101168967,LOC102235987,LOC101064701,LOC103393878 other downstream 1625084 11644017 ~ 11651021 (+)
G104382 NA other downstream 1647265 11666198 ~ 11671340 (+)
AMCG00011115 NA other downstream 1789913 11808846 ~ 11810822 (+)

Expression


Co-expression Network