AMCG00011105 (kcnq4)



Basic Information


Item Value
gene id AMCG00011105
gene name kcnq4
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 11542988 ~ 11552978 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>AMCG00011105
ATGGGTTTCCGGGACCGGATCCGGATGAATAATTCACGCAGCCAGGGTCTACGCAGCAAAGCGTCGCCCGCAACGCCAGTGGGGGTGCGGCGCTCACCCAGCTCTGAGAACGTCCCCGAGGCCGCCAGCCCTGGGAAGGTGCAGAAGAGCTGGAGCTTCAATGACCGGACACGCTTCCGCACCTCGCTGCGGCTCAAACCGCGGCCCACGCCTGACGCCGAGGGGATGGGGGAGGACAGTAATGAGGACAAGTCCTACCACTGTGATGTCACCATGGAGGAGGTCATTCCCGCGGTAAAGACCCTGATCAGGGCAGTTAGGATCCTGAAGTTCCTGGTAGCCAAGAGGAAGTTTAAGGAGACACTGCGGCCGTACGATGTGAAGGATGTTATTGAGCAGTACTCTGCCGGCCACCTGGACATGCTGGGGAGGATCAAGAGCCTGCAGACACGGGTGGACCAGATCGTGGGCCGTGGTGCCATCCAGCCCGACAAGAGGATCCGGAGCGAGAAGGGTGAGAAGACCCCCCCCGAGCTGGACCCCCTGGACGAGCTCAGCATGATGGGCCGCGTGATGAAGGTGGAGAAGCAGGTGCAGTCCATTGAGAACAAGCTGGACCTACTGCTGAACTTCTACACGCAGTGTCTGAAGAAGGGCTCTCCCTTCACGCTGTCCCTCCTGGAGCCGGATCTGACCTCGGACTACCACAGCGCCACCGACCCCCACGACCTCTTCCCTTCAGCCACCACCCTCGACATCTCCCGCTCCGAGAGCACCACGCTGGACTGA

Function


symbol description
kcnq4 Predicted to enable calmodulin binding activity and delayed rectifier potassium channel activity. Predicted to be involved in potassium ion transmembrane transport. Predicted to act upstream of or within potassium ion transport and regulation of ion transmembrane transport. Predicted to be located in membrane. Predicted to be part of voltage-gated potassium channel complex. Predicted to be integral component of membrane. Is expressed in brain; heart; inner ear; and rhombomere 4.

NR:

description
PREDICTED: potassium voltage-gated channel subfamily KQT member 4 isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
AMCG00011105 True 789 mRNA 0.61 5 11542988 11552978

Neighbor


gene id symbol gene type direction distance location
AMCG00011107 NA coding upstream 12259 11527210 ~ 11530729 (+)
AMCG00011109 kcnq4 coding upstream 42718 11499565 ~ 11500270 (+)
AMCG00011106 LOC106588897 coding upstream 52957 11472799 ~ 11490031 (+)
AMCG00011102 NA coding upstream 130036 11399849 ~ 11412952 (+)
AMCG00011101 NA coding upstream 173291 11351902 ~ 11369697 (+)
AMCG00011108 NA coding downstream 21562 11574540 ~ 11587206 (+)
AMCG00011111 NA coding downstream 85024 11638002 ~ 11642227 (+)
AMCG00011116 NA coding downstream 280866 11833844 ~ 11839029 (+)
AMCG00011122 NA coding downstream 390621 11943599 ~ 11946001 (+)
AMCG00011121 eef1a1l2,LOC107589444,LOC107706209,LOC105892153,LOC105027913 coding downstream 409420 11962398 ~ 11966995 (+)
G104310 NA non-coding upstream 122922 11418666 ~ 11420066 (+)
G104307 col9a2 non-coding upstream 165903 11372554 ~ 11377085 (+)
G104271 NA non-coding upstream 819098 10723550 ~ 10723890 (+)
G104255 NA non-coding upstream 925792 10555729 ~ 10617196 (+)
G104221 NA non-coding upstream 1670098 9872653 ~ 9872890 (+)
G104443 NA non-coding downstream 291432 11844410 ~ 11844623 (+)
G104444 NA non-coding downstream 291708 11844686 ~ 11845805 (+)
G104445 NA non-coding downstream 293010 11845988 ~ 11846253 (+)
G104479 NA non-coding downstream 361516 11914494 ~ 11917031 (+)
G104480 NA non-coding downstream 364710 11917688 ~ 11918147 (+)
G104273 NA other upstream 723565 10818688 ~ 10819423 (+)
AMCG00011089 csmd2 other upstream 1271125 10203617 ~ 10271863 (+)
AMCG00011076 zbtb8b,LOC107724281,LOC107584246 other upstream 1993468 9530474 ~ 9549520 (+)
G103939 yars,LOC107724337,LOC107687080,LOC107709269 other upstream 2990383 8548363 ~ 8552605 (+)
AMCG00010994 NA other upstream 4439480 7071433 ~ 7103508 (+)
AMCG00011110 zn706,LOC103364770,LOC104931588,LOC101168967,LOC102235987,LOC101064701,LOC103393878 other downstream 91039 11644017 ~ 11651021 (+)
G104382 NA other downstream 113220 11666198 ~ 11671340 (+)
AMCG00011115 NA other downstream 255868 11808846 ~ 11810822 (+)
G104435 NA other downstream 289151 11842129 ~ 11844089 (+)
G104550 NA other downstream 513516 12066494 ~ 12067337 (+)

Expression



Co-expression Network