AMCG00011208


Basic Information

Item Value
gene id AMCG00011208
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 13919668 ~ 13922667 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00011208
ATGTTTCCCAGCCCTCCGACTTCTACCCCCTTTTCTGTGAAGGATATCTTGAACCTGGAGCAAAACCAAGACGAGATGGCCTCACTGGAGATCTCCTCCCGGCTGGACACGGCGCTCTCCTCCGCCTCGTCCTGCATGTTGGCGAGGTTTAAGCAGGAGCCCTATGGCGAGATGCCGCCGGCAGCCTCTCTGTTCAGTGAAGATGTCCCGCAGCCCAAGGCCAGTAGAAACCCCGCTCTTAACTTCACCGCTACCTTTTATGGGAAAAATGTCCTGGAAATGGACATCATCAAAGAAGGGAAGTCAGACGGGAGAACCAAAAGAAAGTGCAAGAGACAGCGGCAGGACCAGACCCTGGAGATGGTGGGCATCGCCCCGCCGAGGCGCATCGCCGTGCCCGTGCTGGTGCGGGACGGCAAGCCCTGTCTAGGGGAGACTCCGGCCTACGGCGGCTCCTACAATGTCGGTATTAACCACTACACCTACAACACCTACCCGGCCTTCTCCAACTACCCCAGCCCGGGCTGCAGCACAAACTATGCCTGCAACTACCCCAGTGCGGCTCTGCAGGGCATCCAGTCCCCCACGGCCAACAGCAACTACGTGAACTTCAGCGTTGGGGACCTGAATAATTCCCAGACGCCCTTTCAGTCCAGTAACGCAGTTTCTTCACTGCATGGCATCAGGGCCTGGTGA

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0055007 cardiac muscle cell differentiation biological_process
GO:0060038 cardiac muscle cell proliferation biological_process
GO:0001947 heart looping biological_process
GO:1901210 regulation of cardiac chamber formation biological_process
GO:0005634 nucleus cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00011208 True 696 mRNA 0.58 3 13919668 13922667

Neighbor

gene id symbol gene type direction distance location
AMCG00011203 NA coding downstream 61398 13856857 ~ 13858270 (-)
AMCG00011198 LOC105011263,LOC107750325,LOC107677389,LOC107587064 coding downstream 140911 13752553 ~ 13778757 (-)
AMCG00011200 NA coding downstream 174443 13743918 ~ 13745225 (-)
AMCG00011194 NA coding downstream 231964 13684634 ~ 13687704 (-)
AMCG00011188 ublcp1,LOC106567438,LOC106603889,LOC107672805 coding downstream 576204 13328493 ~ 13343464 (-)
AMCG00011207 stc2 coding upstream 16692 13939359 ~ 13946548 (-)
AMCG00011216 LOC107713182,LOC107587250,LOC107684217,LOC107581908,LOC107661723,LOC108429399,LOC107727287 coding upstream 288958 14211625 ~ 14340740 (-)
AMCG00011222 stk32a,LOC107692947,LOC108414397,LOC107713578 coding upstream 542490 14465157 ~ 14467077 (-)
AMCG00011223 stk32a,LOC104947536,LOC106965095 coding upstream 559703 14482370 ~ 14489581 (-)
AMCG00011230 NA coding upstream 623404 14546071 ~ 14576028 (-)
G104998 rpl26l1,rl26,LOC105024418,LOC107381811,LOC100708525,LOC103144500 non-coding downstream 52053 13864521 ~ 13867615 (-)
G104928 clint1a,LOC108441628 non-coding downstream 251952 13662186 ~ 13667716 (-)
G104921 NA non-coding downstream 364594 13553440 ~ 13555074 (-)
G104916 NA non-coding downstream 541369 13378057 ~ 13378299 (-)
G104915 NA non-coding downstream 542671 13376133 ~ 13376997 (-)
G105048 NA non-coding upstream 142674 14065341 ~ 14065908 (-)
G105052 NA non-coding upstream 147737 14070404 ~ 14070969 (-)
G105077 LOC106567452,LOC106603868,LOC105011253 non-coding upstream 276160 14198827 ~ 14203536 (-)
G105080 NA non-coding upstream 296288 14218955 ~ 14261910 (-)
G105105 NA non-coding upstream 497034 14419701 ~ 14420053 (-)
G104929 NA other downstream 240406 13665795 ~ 13679262 (-)
G104909 NA other downstream 552594 13365083 ~ 13367074 (-)
AMCG00011174 slc23a1,pwwp2a,LOC106603911,LOC102781148 other downstream 963401 12942390 ~ 12956267 (-)
AMCG00011169 NA other downstream 1092788 12821025 ~ 12826880 (-)
G104749 NA other downstream 1279441 12634856 ~ 12640227 (-)
AMCG00011211 NA other upstream 71316 13993983 ~ 13996589 (-)
G105050 NA other upstream 144548 14067215 ~ 14068561 (-)
G105290 LOC108429417 other upstream 1447735 15370402 ~ 15373179 (-)
AMCG00011251 gfpt2,LOC106611946,LOC105024910,LOC108240504,LOC107375897 other upstream 1576867 15499534 ~ 15515675 (-)
AMCG00011259 pcbd2,LOC107386701,LOC105890513,LOC106941140,LOC103129816 other upstream 2040671 15963338 ~ 15973872 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000000_17562353_17564258 NKX2.5 coding CI01000000 null 17561881 ~ 17564639 (-)