AMCG00011284


Basic Information

Item Value
gene id AMCG00011284
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 16745597 ~ 16746212 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00011284
ATGCTTTTTCTTGGAGGAGCAGTTATTCTTTTAATTCAACTGGTGCCTAAAGATTTACACGCCTTGGCCTTGACACTGGAGATGCTGGGGAAGTCTGGCATCACGTCTGCCTTCTGTATTGTCTACGCCATCACTGCAGAGCTCTATCCCACCGTGGTGAGGAACATGGCTATGGGCACCTGCTCCATGGCTGCTCGGATTGGCAACATCATCTCTCCCTACCTGGCCTTGCTATTGTCTCTGGAGCGCTGCCCTTCCTTCTGCCCTAAGGTTTCCGAGTGTCTCTTCATCTCTTGA

Function

GO:

id name namespace
GO:0055085 transmembrane transport biological_process
GO:0001887 selenium compound metabolic process biological_process
GO:0015698 inorganic anion transport biological_process
GO:0051597 response to methylmercury biological_process
GO:0050787 detoxification of mercury ion biological_process
GO:0016021 integral component of membrane cellular_component
GO:0022857 transmembrane transporter activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00011284 True 297 mRNA 0.51 3 16745597 16746212

Neighbor

gene id symbol gene type direction distance location
AMCG00011283 NA coding downstream 45676 16664913 ~ 16699921 (-)
AMCG00011281 NA coding downstream 81193 16637296 ~ 16664404 (-)
AMCG00011279 rapgef6 coding downstream 166005 16540657 ~ 16579592 (-)
AMCG00011273 NA coding downstream 546058 16198120 ~ 16199539 (-)
AMCG00011274 tcf7 coding downstream 568531 16149736 ~ 16177066 (-)
AMCG00011282 NA coding upstream 7444 16753656 ~ 16764495 (-)
AMCG00011286 NA coding upstream 30139 16776351 ~ 16804290 (-)
AMCG00011292 kif3a coding upstream 164108 16910320 ~ 16920194 (-)
AMCG00011291 pou4f3,LOC106603866,LOC106567605 coding upstream 188294 16934506 ~ 16935842 (-)
AMCG00011294 NA coding upstream 232386 16978598 ~ 17004504 (-)
G105553 NA non-coding downstream 20444 16655247 ~ 16725153 (-)
G105479 NA non-coding downstream 498296 16244696 ~ 16247301 (-)
G105473 vdac1,LOC106567523,LOC107557296 non-coding downstream 507912 16236128 ~ 16237685 (-)
G105454 zgc:56064,LOC102205414,LOC107684868,LOC107564119 non-coding downstream 604259 16139099 ~ 16141338 (-)
G105427 sar1b,LOC106940938,LOC107657201 non-coding downstream 710574 16032251 ~ 16035023 (-)
G105607 NA non-coding upstream 147748 16893960 ~ 16895074 (-)
G105701 NA non-coding upstream 563578 17309790 ~ 17312068 (-)
G105752 NA non-coding upstream 813190 17559402 ~ 17561795 (-)
G105761 LOC103029292,LOC108441031,LOC106604913,LOC108424167,LOC103354367 non-coding upstream 817957 17564169 ~ 17566963 (-)
G105774 NA non-coding upstream 1008115 17754327 ~ 17755758 (-)
AMCG00011271 LOC107562913 other downstream 647418 16043371 ~ 16098179 (-)
AMCG00011259 pcbd2,LOC107386701,LOC105890513,LOC106941140,LOC103129816 other downstream 771725 15963338 ~ 15973872 (-)
AMCG00011251 gfpt2,LOC106611946,LOC105024910,LOC108240504,LOC107375897 other downstream 1229922 15499534 ~ 15515675 (-)
G105290 LOC108429417 other downstream 1372418 15370402 ~ 15373179 (-)
G105050 NA other downstream 2677036 14067215 ~ 14068561 (-)
AMCG00011290 rbm27,LOC106567487 other upstream 197720 16943932 ~ 16961069 (-)
AMCG00011313 NA other upstream 971414 17717626 ~ 17751099 (-)
G105770 NA other upstream 1005041 17751253 ~ 17751502 (-)
G105793 NA other upstream 1253456 17999668 ~ 18000445 (-)
AMCG00011316 LOC107664359,LOC107560145,LOC108427843,LOC107752026,LOC105007072,LOC103354679 other upstream 1434434 18180646 ~ 18191195 (-)

Expression


Co-expression Network