AMCG00011318 (med7,LOC107744582,LOC107669063,LOC107752091,LOC107664325,LOC107561400)


Basic Information

Item Value
gene id AMCG00011318
gene name med7,LOC107744582,LOC107669063,LOC107752091,LOC107664325,LOC107561400
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 18196541 ~ 18197251 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00011318
ATGGGTGAGCCACAGCAAGTCAGTGCCCTTCCTCCCCCCCCCATGCAGTACATCAAGGAATACACTGATGACAATGTGCGCAAAGGCCTTGCTCCCAGACCTCCTCCCCCAATCAAGGACAGCTACATGATGTTTGGCAACCAGTTCCAGTGTGATGAACTCATAATACGCCCTCTGGAAACCCAGGGAATTGAGCGTCTCCACCCAATGCAATTTGATCACAAGAAAGAACTAAAGAAACTTAACATGTCCATTCTGGTGAACTTCCTGGACCTCTTGGACATCTTAATCAAAAGCCCAGGCAGCATTAAGAGAGAGGAGAAGCTGGAAGACTTGAAACTGCTTTTTGTCCACATGCACCATCTAATTAACGAGTACCGGCCACACCAGGCTCGAGAGACACTGCGTGTGATGATGGAGGTGCAGAAGCGGCAGCGTCTTGAGACGGCAGAGCGCTTCCAGAAGCATCTCGAGAGAGTGGTGGAAATGATCCAAGGCTGCCTGGCCTCGCTCCCAGATGACCTGCCCCAGCCGGAGGGAGCCTCAGGGGGTATGCCACGACTGAAAGCTGAGCCCATGGATGTAGACGAGGCAGGCAGCAGCTGCATGATCGGCCAGGTGGACAAAGACAAGGAAACTGCCTTGTTGAAAAAGGACAAAGTGTGGGATAAGGATGCAGCAATGTGCAGCATTATTGACGAAATGACTTAA

Function

symbol description
med7 Predicted to enable transcription coregulator activity. Predicted to act upstream of or within regulation of transcription by RNA polymerase II. Predicted to be located in nucleus. Predicted to be part of mediator complex. Orthologous to human MED7 (mediator complex subunit 7).

NR:

description
PREDICTED: mediator of RNA polymerase II transcription subunit 7

GO: NA

KEGG:

id description
K15148 MED7; mediator of RNA polymerase II transcription subunit 7

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00011318 True 711 mRNA 0.52 1 18196541 18197251

Neighbor

gene id symbol gene type direction distance location
AMCG00011314 LOC107743918,LOC107752029,LOC107664328,LOC107568687,LOC107669111 coding downstream 403035 17786920 ~ 17793506 (-)
AMCG00011315 LOC106604410,LOC107752029,LOC107743918,LOC107602558 coding downstream 410699 17784040 ~ 17785842 (-)
AMCG00011311 NA coding downstream 423376 17761910 ~ 17773165 (-)
AMCG00011303 NA coding downstream 743773 17434502 ~ 17452768 (-)
AMCG00011304 NA coding downstream 800554 17379726 ~ 17395987 (-)
AMCG00011317 NA coding upstream 74161 18271412 ~ 18272204 (-)
AMCG00011330 NA coding upstream 919246 19116497 ~ 19121979 (-)
AMCG00011334 NA coding upstream 1003245 19200496 ~ 19208029 (-)
AMCG00011333 NA coding upstream 1012571 19209822 ~ 19217839 (-)
AMCG00011332 NA coding upstream 1050373 19247624 ~ 19261952 (-)
G105795 NA non-coding downstream 163396 18032755 ~ 18033145 (-)
G105787 NA non-coding downstream 198816 17997438 ~ 17997725 (-)
G105786 NA non-coding downstream 389612 17806679 ~ 17806929 (-)
G105782 NA non-coding downstream 396254 17797443 ~ 17800287 (-)
G105774 NA non-coding downstream 440783 17754327 ~ 17755758 (-)
G105840 NA non-coding upstream 43425 18240676 ~ 18244145 (-)
G105859 LOC105030512,LOC106609167,LOC106569888 non-coding upstream 419598 18616849 ~ 18617084 (-)
G105918 NA non-coding upstream 1036471 19233722 ~ 19244483 (-)
G105967 ndst1,LOC106611870,LOC107094997 non-coding upstream 1179262 19376513 ~ 19376908 (-)
G105968 NA non-coding upstream 1199542 19396793 ~ 19480084 (-)
AMCG00011316 LOC107664359,LOC107560145,LOC108427843,LOC107752026,LOC105007072,LOC103354679 other downstream 5346 18180646 ~ 18191195 (-)
G105793 NA other downstream 196096 17999668 ~ 18000445 (-)
G105770 NA other downstream 445039 17751253 ~ 17751502 (-)
AMCG00011313 NA other downstream 445442 17717626 ~ 17751099 (-)
AMCG00011290 rbm27,LOC106567487 other downstream 1235472 16943932 ~ 16961069 (-)
G105890 NA other upstream 905042 19102293 ~ 19105269 (-)
G105970 rps14,RPS14,rs14,LOC100194652,LOC107685488,LOC107588790 other upstream 1213117 19410368 ~ 19413015 (-)
AMCG00011356 ndufa2,ndua2,LOC106602938,LOC107661794,LOC107569768 other upstream 1668363 19865614 ~ 19867902 (-)
AMCG00011391 smad5,LOC107664766,LOC107563595,LOC105912044 other upstream 4345398 22542649 ~ 22554137 (-)
AMCG00011399 NA other upstream 4546179 22743430 ~ 22753616 (-)

Expression


Co-expression Network