AMCG00011383 (mgat4b,LOC106604568,LOC107550986,LOC107745197,LOC107733437)


Basic Information

Item Value
gene id AMCG00011383
gene name mgat4b,LOC106604568,LOC107550986,LOC107745197,LOC107733437
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 21064143 ~ 21074776 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00011383
GATGTGGTGGACATCTACCAGCGAGAGTTCTTGGCACTGAGGGACCGGCTTCACTCGGCTGAACAGGAGAACCTCAAGCGATCAAAGGAGCTCAACCTGGTCCTGGACGAAATCAAGAGGGCTATCGCTGAGAAGCAGGCCCTGAGGGACATCAATCACACCTGGAGCAGCCTCTCAGATGAAACCAAGCTGAAACTCTGGAATGTCACCAGTAAGAATGTGCTTCAGCTGCCCAGCATCTTCCACCACCTCCCTCACCTGCTGGCCAAGGAGAACAGCCTGCAGCCCGCCGTGCACGTGGGCCAGGGCCGGACGGGCGTGTCGATCGTGATGGGCATCCCCAGTGTGAAGAGAGAAGTGCATTCTTACCTCACCGACACCCTCAACTCTCTGATGTCTGAACTCAGCAGTGCCGAGAGGGAGGACTGTGTCATCGTGGTTTTCATCGCTGAGTCTGGCCTGCTAGAAATCATCTCTCCATCCATCAACTTCTACCCTGATTTTTCTCGGCTGAAGGAATCTTTTGGGGATCCCAAGGAAAGGGTC

Function

symbol description
mgat4b Predicted to enable acetylglucosaminyltransferase activity. Predicted to be involved in protein N-linked glycosylation. Predicted to be located in Golgi membrane. Predicted to be integral component of membrane. Predicted to be active in Golgi stack; endoplasmic reticulum; and endoplasmic reticulum-Golgi intermediate compartment. Orthologous to human MGAT4B (alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase B).

NR:

description
PREDICTED: alpha-1,3-mannosyl-glycoprotein 4-beta-N-acetylglucosaminyltransferase B

GO:

id name namespace
GO:0006486 protein glycosylation biological_process
GO:0000139 Golgi membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008454 alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity molecular_function
GO:0046872 metal ion binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00011383 True 546 mRNA 0.55 4 21064143 21074776

Neighbor

gene id symbol gene type direction distance location
AMCG00011385 mgat4b,LOC106604568 coding downstream 15894 21032802 ~ 21048249 (-)
AMCG00011384 NA coding downstream 42206 21011871 ~ 21021937 (-)
AMCG00011377 NA coding downstream 56803 20994452 ~ 21007340 (-)
AMCG00011378 NA coding downstream 75100 20981409 ~ 20989043 (-)
AMCG00011379 NA coding downstream 86984 20976683 ~ 20977159 (-)
AMCG00011382 tbc1d9b,LOC108438817 coding upstream 60650 21135426 ~ 21153802 (-)
AMCG00011386 NA coding upstream 86553 21161329 ~ 21214630 (-)
AMCG00011393 NA coding upstream 1489323 22564099 ~ 22600783 (-)
AMCG00011400 NA coding upstream 1619365 22694141 ~ 22694827 (-)
AMCG00011398 NA coding upstream 1663902 22738678 ~ 22743075 (-)
G106340 NA non-coding downstream 111288 20951760 ~ 20952855 (-)
G106300 NA non-coding downstream 152005 20911919 ~ 20912138 (-)
G106278 NA non-coding downstream 448501 20615438 ~ 20615642 (-)
G106266 NA non-coding downstream 575955 20486271 ~ 20488188 (-)
G106224 NA non-coding downstream 787838 20272063 ~ 20276305 (-)
G106448 LOC106604502,LOC105008787 non-coding upstream 720849 21795625 ~ 21799926 (-)
G106453 LOC103471465,LOC102309231,LOC102203450,LOC107738605 non-coding upstream 800036 21874812 ~ 21875126 (-)
G106454 NA non-coding upstream 852077 21926853 ~ 21928367 (-)
G106509 NA non-coding upstream 1575724 22650500 ~ 22653658 (-)
G106527 NA non-coding upstream 1621811 22696587 ~ 22696846 (-)
AMCG00011356 ndufa2,ndua2,LOC106602938,LOC107661794,LOC107569768 other downstream 1196241 19865614 ~ 19867902 (-)
G105970 rps14,RPS14,rs14,LOC100194652,LOC107685488,LOC107588790 other downstream 1651128 19410368 ~ 19413015 (-)
G105890 NA other downstream 1958874 19102293 ~ 19105269 (-)
AMCG00011316 LOC107664359,LOC107560145,LOC108427843,LOC107752026,LOC105007072,LOC103354679 other downstream 2872948 18180646 ~ 18191195 (-)
G105793 NA other downstream 3063698 17999668 ~ 18000445 (-)
AMCG00011391 smad5,LOC107664766,LOC107563595,LOC105912044 other upstream 1467873 22542649 ~ 22554137 (-)
AMCG00011399 NA other upstream 1668654 22743430 ~ 22753616 (-)
AMCG00011409 NA other upstream 1978537 23053313 ~ 23060966 (-)
AMCG00011414 NA other upstream 2318328 23393104 ~ 23489642 (-)
AMCG00011428 NA other upstream 2739081 23813857 ~ 23817543 (-)

Expression


Co-expression Network