G102360



Basic Information


Item Value
gene id G102360
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 287273 ~ 287693 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU127832
gtctgtcagatcaataggtgattggttcttgagtttttgagattggatttcagtttcagcccccagtgtcctattggaggggggcttgatttatgactgatgtcaatccatgccatcttttggaaatgccggttggcccgggttcgtagctctatgtcgggatttcggctctcgtccacttcaaagagtttttattacctacaggcccctttctccagacatctcatagcaggattccaaactatttggcctattctcggtgccatcctccccaaaactgtcattttgatgtaaaccagttccaagctgatgagttaaggaaatctgataactttggggggggagaggtcttctttagatcagtgcttcagctcagagcccaaatgctcttatcaaaatacacccaacataacgctacaat

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU127832 True 421 lncRNA 0.45 1 287273 287693
Loading

Neighbor


gene id symbol gene type direction distance location
AMCG00010797 NA coding downstream 94198 157490 ~ 193075 (-)
AMCG00010791 NA coding downstream 130476 151074 ~ 156797 (-)
AMCG00010790 NA coding downstream 153179 133732 ~ 134094 (-)
AMCG00010796 NA coding downstream 153949 126979 ~ 133324 (-)
AMCG00010792 stk40 coding downstream 160674 114818 ~ 126599 (-)
AMCG00010798 grik3 coding upstream 277538 565231 ~ 577174 (-)
AMCG00010799 grik3,LOC106605119,LOC106583195 coding upstream 300163 587856 ~ 629893 (-)
AMCG00010802 NA coding upstream 647490 935183 ~ 943466 (-)
AMCG00010807 maneal,LOC105903681,LOC106583256,LOC102777073 coding upstream 754308 1042001 ~ 1056921 (-)
AMCG00010813 NA coding upstream 845077 1132770 ~ 1136837 (-)
G102332 NA non-coding downstream 155691 131350 ~ 131582 (-)
G102362 NA non-coding upstream 56 287749 ~ 287971 (-)
G102367 NA non-coding upstream 199580 487273 ~ 487531 (-)
G102372 NA non-coding upstream 272741 560434 ~ 560797 (-)
G102432 NA non-coding upstream 678269 965962 ~ 966216 (-)
G102433 NA non-coding upstream 686742 974435 ~ 974641 (-)
AMCG00010794 NA other downstream 137444 136369 ~ 149829 (-)
G102434 NA other upstream 687860 975553 ~ 978127 (-)
AMCG00010806 NA other upstream 746137 1033830 ~ 1034874 (-)
AMCG00010843 NA other upstream 2194181 2481874 ~ 2496446 (-)
G102762 NA other upstream 2452123 2739816 ~ 2778023 (-)
G102774 NA other upstream 2470785 2758478 ~ 2761264 (-)

Expression


G102360 Expression in all Baseline Samples

Bar chart with 16 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G102360 Expression in each Bioproject

Bar chart with 7 bars.
G102360 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network