G102623


Basic Information

Item Value
gene id G102623
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 2252119 ~ 2252467 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU128146
ttaataactaagtgatcaaggatcctatccagtctgtttttgaatgttcccaaattgtctcttcagccacatcactggggagtttgttcagattgtgacgcctctctgtgtgaagaagtgtctcctgttttctgtcttgaatgccttgaagcccaatttccatttgtgtccccgggtgcgtgtgtccctgctgatctggaaaagctcctctggtttgatgtggtcgatgtctttcatgattttgaagacttggatcaagtccccatgtagtctcctctgttccagggtgaaaaggttcagttcctcagtctctcagtaggacattcccttcagacctggaataagtctg

Function

GO: NA

KEGG:

id description
ko00513 Various types of N-glycan biosynthesis

RNA

RNA id representative length rna type GC content exon number start site end site
TU128146 True 349 lncRNA 0.46 1 2252119 2252467

Neighbor

gene id symbol gene type direction distance location
AMCG00010835 oprd1a,LOC108411271,LOC107595906,LOC107732912 coding downstream 69647 2180504 ~ 2182472 (-)
AMCG00010836 NA coding downstream 71622 2143118 ~ 2180497 (-)
AMCG00010827 pkib,LOC105417165,LOC107098269,LOC107374466 coding downstream 415234 1821651 ~ 1836885 (-)
AMCG00010829 stmn1,LOC107587743,LOC104924882,LOC103040240,LOC107700727,LOC107597104 coding downstream 451359 1798219 ~ 1800760 (-)
AMCG00010828 NA coding downstream 455527 1792777 ~ 1796592 (-)
AMCG00010840 NA coding upstream 79749 2332216 ~ 2336743 (-)
AMCG00010839 NA coding upstream 113006 2365473 ~ 2382245 (-)
AMCG00010841 fam46ba,LOC107597110,LOC108443429,LOC107587747,LOC107734389,LOC107704962,LOC107700733 coding upstream 189760 2442227 ~ 2449554 (-)
AMCG00010842 NA coding upstream 247338 2499805 ~ 2502500 (-)
AMCG00010844 arid1a,LOC106588635 coding upstream 254253 2506720 ~ 2519791 (-)
G102615 NA non-coding downstream 74603 2177276 ~ 2177516 (-)
G102609 NA non-coding downstream 80318 2171530 ~ 2171801 (-)
G102572 NA non-coding downstream 288166 1962282 ~ 1963953 (-)
G102562 NA non-coding downstream 339166 1857460 ~ 1912953 (-)
G102543 NA non-coding downstream 444031 1807629 ~ 1808088 (-)
G102629 NA non-coding upstream 64298 2316765 ~ 2317264 (-)
G102639 NA non-coding upstream 110413 2362880 ~ 2363110 (-)
G102651 NA non-coding upstream 134256 2386723 ~ 2437698 (-)
G102725 NA non-coding upstream 422096 2674563 ~ 2675136 (-)
G102785 NA non-coding upstream 537003 2789470 ~ 2833183 (-)
AMCG00010806 NA other downstream 1217245 1033830 ~ 1034874 (-)
G102434 NA other downstream 1273992 975553 ~ 978127 (-)
AMCG00010794 NA other downstream 2102290 136369 ~ 149829 (-)
AMCG00010843 NA other upstream 229407 2481874 ~ 2496446 (-)
G102762 NA other upstream 487349 2739816 ~ 2778023 (-)
G102774 NA other upstream 506011 2758478 ~ 2761264 (-)
G102902 LOC104921322 other upstream 927503 3179970 ~ 3182619 (-)
G102990 NA other upstream 1068346 3320813 ~ 3419176 (-)

Expression


Co-expression Network