G105145 (atp10d,atp10b)


Basic Information

Item Value
gene id G105145
gene name atp10d,atp10b
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 14671298 ~ 14671549 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU131520
GTTTTCTTGATGAGAGAACTCTGTGCCCAAGATAGAGCAGCGGCGGAAAACCATTTTGTTCTCGGTAAGTGTTCCTGTCTTGTCTGAGAACACGTACTGGATTTGCCCAAGGTCCTCGGTTATGTTCAGAGCCCGGCATTCCAGGCGTCTGTCCGTCTCCTCATCGTAAAGGTCAAGATCATTGCTGATGAAAAAGATCTGACCCATTTTCACAATTTCGATGGACACGTACAGAGAGATAGGAATCAACAC

Function

symbol description
atp10d Predicted to enable ATPase-coupled intramembrane lipid transporter activity. Predicted to be involved in phospholipid translocation. Predicted to act upstream of or within phospholipid transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Orthologous to human ATP10D (ATPase phospholipid transporting 10D (putative)).
atp10b Predicted to enable ATPase-coupled intramembrane lipid transporter activity. Predicted to be involved in phospholipid translocation. Predicted to act upstream of or within phospholipid transport. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Orthologous to human ATP10B (ATPase phospholipid transporting 10B (putative)).

NR:

description
probable phospholipid-transporting ATPase VD

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU131520 True 252 lncRNA 0.47 1 14671298 14671549

Neighbor

gene id symbol gene type direction distance location
AMCG00011224 LOC108435599,LOC101068624,LOC105904085 coding upstream 62715 14598190 ~ 14608583 (+)
AMCG00011221 NA coding upstream 132439 14502980 ~ 14538859 (+)
AMCG00011218 dpyl3,dpysl3,LOC106567513,LOC105900346 coding upstream 221621 14427479 ~ 14449677 (+)
AMCG00011220 NA coding upstream 244668 14419728 ~ 14426630 (+)
AMCG00011219 LOC103361792,LOC102209146 coding upstream 260282 14396782 ~ 14411016 (+)
AMCG00011226 NA coding downstream 224647 14896196 ~ 14906606 (+)
AMCG00011225 gabra1,LOC106567505 coding downstream 270212 14941761 ~ 14963439 (+)
AMCG00011227 gabrg2,LOC107603256,LOC107661671 coding downstream 344246 15015795 ~ 15023060 (+)
AMCG00011228 gabrg2 coding downstream 362390 15033939 ~ 15041745 (+)
AMCG00011234 nudcd2 coding downstream 559898 15231447 ~ 15233722 (+)
G105144 NA non-coding upstream 370 14670719 ~ 14670928 (+)
G105143 NA non-coding upstream 6145 14664620 ~ 14665153 (+)
G105113 NA non-coding upstream 212280 14456102 ~ 14459018 (+)
G105078 LOC103376870 non-coding upstream 409282 14218950 ~ 14262016 (+)
G105051 NA non-coding upstream 600329 14070400 ~ 14070969 (+)
G105186 NA non-coding downstream 257094 14928643 ~ 14928940 (+)
G105226 NA non-coding downstream 578189 15249738 ~ 15256622 (+)
G105238 NA non-coding downstream 608906 15280455 ~ 15283748 (+)
G105365 NA non-coding downstream 1149759 15821308 ~ 15839105 (+)
G105370 NA non-coding downstream 1188209 15859758 ~ 15861690 (+)
G105139 LOC100846954 other upstream 50764 14619690 ~ 14620534 (+)
AMCG00011209 cpeb4,LOC106603870 other upstream 610271 14013121 ~ 14061027 (+)
AMCG00011210 bod1,LOC107581912,LOC107661728,LOC107713186,LOC107662284,LOC107587245,LOC108278584,LOC106603873 other upstream 678453 13985665 ~ 13992845 (+)
AMCG00011204 NA other upstream 793016 13868337 ~ 13878282 (+)
G104815 slc23a1,pwwp2a,LOC106603911,LOC102781148 other upstream 1728216 12942380 ~ 12943082 (+)
AMCG00011241 LOC102221627,LOC107740141,LOC107680337,LOC107593202 other downstream 649231 15320780 ~ 15322658 (+)
AMCG00011250 NA other downstream 800710 15472259 ~ 15487372 (+)
AMCG00011253 NA other downstream 1179097 15850646 ~ 15852389 (+)
AMCG00011252 NA other downstream 1182215 15853764 ~ 15855784 (+)
AMCG00011255 LOC106603967,LOC105011194,LOC108410970 other downstream 1191483 15863032 ~ 15873489 (+)

Expression


Co-expression Network