G106455


Basic Information

Item Value
gene id G106455
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 21932604 ~ 22062654 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU133192
CCGGATGCGGTTGCGCAGTCAGAAGGTCAGCTTGCAGCTGCTTCAAATGTGTAAGGTTAAAGGTGTCTCCAAAAACATGTAGCAGAAATCTCCATTCCCCAGAGACCAAATATCATTCTGAAGATGTGACGATTGAGGAGGACAGCCTGCACACAGAAACAACAGAAGGTTGGAAACGTGGAGACTGGAGTCAGCCTGTTTGCAGATGCTGATATTGAGACGCTGGGGCTCGACCAGG

Function

GO:

id name namespace
GO:0031231 intrinsic component of peroxisomal membrane cellular_component
GO:0005777 peroxisome cellular_component
GO:0005778 peroxisomal membrane cellular_component
GO:0005779 integral component of peroxisomal membrane cellular_component
GO:0044438 obsolete microbody part cellular_component
GO:0044439 obsolete peroxisomal part cellular_component
GO:0031903 microbody membrane cellular_component
GO:0042579 microbody cellular_component

KEGG:

id description
ko00061 Fatty acid biosynthesis

RNA

RNA id representative length rna type GC content exon number start site end site
TU133192 True 238 lncRNA 0.50 3 21932604 22062654

Neighbor

gene id symbol gene type direction distance location
AMCG00011389 NA coding upstream 8346 21923959 ~ 21924258 (+)
AMCG00011390 pcdh1b,LOC107738605,LOC107740130,LOC107593598,LOC107680965,LOC106604502,LOC108438453,LOC107564069 coding upstream 56271 21868788 ~ 21876333 (+)
AMCG00011388 LOC105008787,LOC106604502 coding upstream 134641 21792528 ~ 21797963 (+)
AMCG00011387 NA coding upstream 546741 21319424 ~ 21385863 (+)
AMCG00011381 NA coding upstream 695849 21227210 ~ 21236755 (+)
AMCG00011392 NA coding downstream 441318 22503972 ~ 22506745 (+)
AMCG00011394 NA coding downstream 537264 22599918 ~ 22603575 (+)
AMCG00011395 NA coding downstream 541362 22604016 ~ 22630597 (+)
AMCG00011397 LOC108416539,LOC105007475 coding downstream 583378 22646032 ~ 22650834 (+)
AMCG00011396 NA coding downstream 607087 22669741 ~ 22691805 (+)
G106443 NA non-coding upstream 4027 21926899 ~ 21928577 (+)
G106391 NA non-coding upstream 691111 21215621 ~ 21241493 (+)
G106362 NA non-coding upstream 797991 21134255 ~ 21134613 (+)
G106361 NA non-coding upstream 800174 21131698 ~ 21132430 (+)
G106347 NA non-coding upstream 899416 21028793 ~ 21033188 (+)
G106457 NA non-coding downstream 27403 22090057 ~ 22090265 (+)
G106464 NA non-coding downstream 249060 22311714 ~ 22311963 (+)
G106478 NA non-coding downstream 480625 22543279 ~ 22544072 (+)
G106477 smad1,smad5,LOC107598346 non-coding downstream 481530 22544184 ~ 22544435 (+)
G106479 NA non-coding downstream 484510 22547164 ~ 22547407 (+)
G106242 NA other upstream 1565381 20361208 ~ 20367223 (+)
AMCG00011365 LOC108438827,LOC108243066,LOC107376386 other upstream 1593279 20296011 ~ 20339325 (+)
G106139 LOC108275110 other upstream 1769638 20095229 ~ 20162966 (+)
G105916 NA other upstream 2710183 19222055 ~ 19222421 (+)
AMCG00011328 NA other upstream 2815235 19107273 ~ 19117369 (+)
G106613 NA other downstream 1278654 23341308 ~ 23341765 (+)
G106618 NA other downstream 1293408 23356062 ~ 23356559 (+)
G106711 zgc:175280,slc7a1,LOC107719755,LOC107702889,LOC107557764,LOC103353344,LOC106563607 other downstream 1686020 23748674 ~ 23753002 (+)
AMCG00011430 dctn4,LOC107749746,LOC106604160 other downstream 1773165 23835819 ~ 23844911 (+)
AMCG00011455 unc5a,LOC107677380,LOC107653334 other downstream 3545332 25607986 ~ 25662179 (+)

Expression


Co-expression Network