G106477 (smad1,smad5,LOC107598346)


Basic Information

Item Value
gene id G106477
gene name smad1,smad5,LOC107598346
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 22544184 ~ 22544435 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU133215
TGACGAAACTCATGCGGATAGTGCACATCTTTGTGAGCTCGTAAACAGCCTCGAAACCATGGTTGACAGACTGAGCCAGCAGCTGGGCAAACTCCTGGTTGTTGAAGATCTTGAGGCTGCAGCCGCTGGGGATCTTGCAGACTGTGGTGGGATGGAAGCCGTGGTGGTAGTTGCAGTTTCTGCTCTGGACGAAGATACTGGTGTCGCTCAGGCACTCAGCGTACACCTCCCCTCCCACATAGTAGAGGTGGA

Function

symbol description
smad5 Enables transcription cis-regulatory region binding activity. Acts upstream of or within several processes, including determination of ventral identity; embryonic morphogenesis; and vasculature development. Predicted to be located in cytoplasm and nucleus. Predicted to be part of heteromeric SMAD protein complex. Is expressed in eye; margin; and posterior lateral line primordium. Orthologous to human SMAD5 (SMAD family member 5).
smad1 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific; I-SMAD binding activity; and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in BMP signaling pathway and embryonic pattern specification. Acts upstream of or within dorsal/ventral pattern formation; myeloid cell development; and negative regulation of transcription, DNA-templated. Predicted to be located in cytoplasm and nucleus. Predicted to be part of heteromeric SMAD protein complex. Is expressed in several structures, including artery; fin; immature eye; mesoderm; and nervous system. Orthologous to human SMAD1 (SMAD family member 1).

NR:

description
PREDICTED: mothers against decapentaplegic homolog 1-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU133215 True 252 lncRNA 0.54 1 22544184 22544435

Neighbor

gene id symbol gene type direction distance location
AMCG00011392 NA coding upstream 37439 22503972 ~ 22506745 (+)
AMCG00011389 NA coding upstream 619926 21923959 ~ 21924258 (+)
AMCG00011390 pcdh1b,LOC107738605,LOC107740130,LOC107593598,LOC107680965,LOC106604502,LOC108438453,LOC107564069 coding upstream 667851 21868788 ~ 21876333 (+)
AMCG00011388 LOC105008787,LOC106604502 coding upstream 746221 21792528 ~ 21797963 (+)
AMCG00011387 NA coding upstream 1158321 21319424 ~ 21385863 (+)
AMCG00011394 NA coding downstream 55483 22599918 ~ 22603575 (+)
AMCG00011395 NA coding downstream 59581 22604016 ~ 22630597 (+)
AMCG00011397 LOC108416539,LOC105007475 coding downstream 101597 22646032 ~ 22650834 (+)
AMCG00011396 NA coding downstream 125306 22669741 ~ 22691805 (+)
AMCG00011404 NA coding downstream 200086 22744521 ~ 22749846 (+)
G106478 NA non-coding upstream 112 22543279 ~ 22544072 (+)
G106464 NA non-coding upstream 232221 22311714 ~ 22311963 (+)
G106457 NA non-coding upstream 453919 22090057 ~ 22090265 (+)
G106455 NA non-coding upstream 481530 21932604 ~ 22062654 (+)
G106443 NA non-coding upstream 615607 21926899 ~ 21928577 (+)
G106479 NA non-coding downstream 2729 22547164 ~ 22547407 (+)
G106481 NA non-coding downstream 9824 22554259 ~ 22554490 (+)
G106485 NA non-coding downstream 19664 22564099 ~ 22567261 (+)
G106513 NA non-coding downstream 148302 22692737 ~ 22694844 (+)
G106586 NA non-coding downstream 318173 22862608 ~ 22862952 (+)
G106242 NA other upstream 2176961 20361208 ~ 20367223 (+)
AMCG00011365 LOC108438827,LOC108243066,LOC107376386 other upstream 2204859 20296011 ~ 20339325 (+)
G106139 LOC108275110 other upstream 2381218 20095229 ~ 20162966 (+)
G105916 NA other upstream 3321763 19222055 ~ 19222421 (+)
AMCG00011328 NA other upstream 3426815 19107273 ~ 19117369 (+)
G106613 NA other downstream 796873 23341308 ~ 23341765 (+)
G106618 NA other downstream 811627 23356062 ~ 23356559 (+)
G106711 zgc:175280,slc7a1,LOC107719755,LOC107702889,LOC107557764,LOC103353344,LOC106563607 other downstream 1204239 23748674 ~ 23753002 (+)
AMCG00011430 dctn4,LOC107749746,LOC106604160 other downstream 1291384 23835819 ~ 23844911 (+)
AMCG00011455 unc5a,LOC107677380,LOC107653334 other downstream 3063551 25607986 ~ 25662179 (+)

Expression


Co-expression Network