G107004 (ergic1)


Basic Information

Item Value
gene id G107004
gene name ergic1
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 25882692 ~ 25888838 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU133839
GAACGTTCTCAACCTGTAGCTTTTCCCCGAAGGCCAGTTTGTGGATGACATGGGTCATGTCCGGATTCTGGGGCTGGGCTGTGGCACTGTGTGTGGATACATGAAAGTTGCCAGGTACTTTGTTTATGCTGAATTTCCCTTCAAATCGGCAGCCGTAGCCATTGTTCAGGGGGACTTTCATGGAGTTGTCAATGTGGCCAACTTCATGTCTCCCCATCTCATCTTGAATATCTAACCCAACGAGATCACAGTTCAAGTTTGGCAAACTGATGTTTAAACTCACATCTATCTTCCCCCCACTGTCCTTATCTGGGTCATCCACATACAGTTCATT

Function

symbol description
ergic1 Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport and retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum. Predicted to act upstream of or within vesicle-mediated transport. Predicted to be located in Golgi apparatus and endoplasmic reticulum-Golgi intermediate compartment membrane. Predicted to be integral component of membrane. Predicted to be active in COPII-coated ER to Golgi transport vesicle; endoplasmic reticulum; and membrane. Predicted to be integral component of Golgi membrane and integral component of endoplasmic reticulum membrane. Human ortholog(s) of this gene implicated in neurogenic-type arthrogryposis multiplex congenita-2. Orthologous to human ERGIC1 (endoplasmic reticulum-golgi intermediate compartment 1).

NR:

description
PREDICTED: endoplasmic reticulum-Golgi intermediate compartment protein 1 isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU133839 True 334 lncRNA 0.47 4 25882692 25888838

Neighbor

gene id symbol gene type direction distance location
AMCG00011460 NA coding upstream 5146 25849573 ~ 25877546 (+)
AMCG00011461 NA coding upstream 70714 25802912 ~ 25811978 (+)
AMCG00011458 NA coding upstream 116614 25761836 ~ 25766078 (+)
AMCG00011452 NA coding upstream 711496 25170708 ~ 25171196 (+)
AMCG00011453 NA coding upstream 712022 25169500 ~ 25170670 (+)
AMCG00011462 dusp1 coding downstream 24686 25913524 ~ 25916673 (+)
AMCG00011464 neurl1b coding downstream 117056 26005894 ~ 26011894 (+)
AMCG00011466 NA coding downstream 145394 26034232 ~ 26035368 (+)
AMCG00011468 LOC103355626 coding downstream 193113 26081951 ~ 26112854 (+)
AMCG00011467 NA coding downstream 238477 26127315 ~ 26135778 (+)
G106994 NA non-coding upstream 87080 25795413 ~ 25795612 (+)
G106973 NA non-coding upstream 162106 25698252 ~ 25720586 (+)
G106966 NA non-coding upstream 205273 25674416 ~ 25677419 (+)
G106961 NA non-coding upstream 214910 25666124 ~ 25667782 (+)
G106947 NA non-coding upstream 510947 25371479 ~ 25371745 (+)
G107084 NA non-coding downstream 311112 26199950 ~ 26202619 (+)
G107098 NA non-coding downstream 388536 26277374 ~ 26292447 (+)
G107126 NA non-coding downstream 498910 26387748 ~ 26387984 (+)
G107128 NA non-coding downstream 558364 26447202 ~ 26451575 (+)
G107321 NA non-coding downstream 1578566 27467404 ~ 27468567 (+)
AMCG00011455 unc5a,LOC107677380,LOC107653334 other upstream 220513 25607986 ~ 25662179 (+)
AMCG00011430 dctn4,LOC107749746,LOC106604160 other upstream 2037781 23835819 ~ 23844911 (+)
G106711 zgc:175280,slc7a1,LOC107719755,LOC107702889,LOC107557764,LOC103353344,LOC106563607 other upstream 2129690 23748674 ~ 23753002 (+)
G106618 NA other upstream 2526133 23356062 ~ 23356559 (+)
G106613 NA other upstream 2540927 23341308 ~ 23341765 (+)
AMCG00011476 NA other downstream 467329 26356167 ~ 26360775 (+)
G107202 NA other downstream 881600 26770438 ~ 26771214 (+)
AMCG00011488 NA other downstream 929214 26818052 ~ 26842792 (+)
G107394 NA other downstream 1823368 27712206 ~ 27727867 (+)
AMCG00011519 NA other downstream 2980304 28869142 ~ 28876355 (+)

Expression


Co-expression Network