G107035 (neurl1b)


Basic Information

Item Value
gene id G107035
gene name neurl1b
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 26005979 ~ 26006456 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU133876
CCTTCGTTGATGCTGTAGAAGACCCGGCCGTGGCGGTCTGCCCAGAAGGCCAGCACATTGTCCCTGAGCGCCAGCCTCTCAGGCAGGGCCTTGGCCCAGTACCCCGGACGGGTCACCAGGTCGGGGCAGGCGTACTTGGGGATCTCGGCAGCGGTGAGCTCTCCAGGGTCCAGGCTGGTGAAGCCGAAGCGCAGGGCCCCGCTCCAGCCGCTGTGGATCCCAGAGAGCCGCAGACGCACCTTCTCGTAGAGTCGCACGGGCCGCTGGCTGAAGGTGATGCCATTGCAGAAGCTGTTCTTGCGAGTGGCCCGCCTCAGCTGCGAGTCCAGGCGGATGTTCTTGCCCTTGGCCAGGGGGTGGAAGCGAGGCGTCTCGCTGTTGAGATTGACAGGCGGAGCCGAGGCCCGCCGCTCCACCACCCCGCTGGGCAGGGTGTAGTACTGCCGGCTGGGCACTGGGCGGTGCTGCAGACTCGCAT

Function

symbol description
neurl1b Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in ubiquitin-dependent endocytosis. Predicted to be active in early endosome. Is expressed in adaxial cell; cardiovascular system; myotome; and somite. Orthologous to human NEURL1B (neuralized E3 ubiquitin protein ligase 1B).

NR:

description
PREDICTED: E3 ubiquitin-protein ligase NEURL1B

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU133876 True 478 lncRNA 0.67 1 26005979 26006456

Neighbor

gene id symbol gene type direction distance location
AMCG00011463 ergic1,LOC107679115,LOC107660430 coding downstream 107152 25877496 ~ 25898827 (-)
AMCG00011459 NA coding downstream 224887 25779962 ~ 25781092 (-)
AMCG00011457 NA coding downstream 275442 25729469 ~ 25730537 (-)
AMCG00011456 NA coding downstream 300311 25681915 ~ 25705668 (-)
AMCG00011454 LOC103356984,LOC101466388,LOC100710497,LOC102193786,LOC102784017 coding downstream 889562 25115557 ~ 25116417 (-)
AMCG00011470 hdac3,LOC107688598,LOC102780161,LOC107746152 coding upstream 107413 26113869 ~ 26120015 (-)
AMCG00011469 NA coding upstream 132510 26138966 ~ 26162878 (-)
AMCG00011474 NA coding upstream 184670 26191126 ~ 26195850 (-)
AMCG00011475 csnk1a1,LOC106604944,LOC107593197,LOC106611977,LOC107554841 coding upstream 313565 26320021 ~ 26334761 (-)
AMCG00011482 NA coding upstream 342132 26348588 ~ 26362055 (-)
G106885 NA non-coding downstream 1014803 24986805 ~ 24991176 (-)
G106862 NA non-coding downstream 1086782 24916164 ~ 24919197 (-)
G106817 NA non-coding downstream 1423805 24581956 ~ 24582174 (-)
G106723 NA non-coding downstream 2208760 23795680 ~ 23797219 (-)
G106682 NA non-coding downstream 2414670 23591101 ~ 23591309 (-)
G107037 NA non-coding upstream 3064 26009520 ~ 26012447 (-)
G107038 NA non-coding upstream 9528 26015984 ~ 26016680 (-)
G107057 NA non-coding upstream 88349 26094805 ~ 26127765 (-)
G107082 hspa9 non-coding upstream 189656 26196112 ~ 26197833 (-)
G107166 NA non-coding upstream 305387 26311843 ~ 26329609 (-)
AMCG00011445 higd2a,LOC107750386,LOC107594954,LOC107677392,LOC107595747,LOC107749757 other downstream 987647 25012205 ~ 25018332 (-)
AMCG00011427 NA other downstream 2170905 23829297 ~ 23835074 (-)
AMCG00011428 NA other downstream 2188436 23813857 ~ 23817543 (-)
AMCG00011414 NA other downstream 2516337 23393104 ~ 23489642 (-)
AMCG00011409 NA other downstream 2945013 23053313 ~ 23060966 (-)
AMCG00011465 NA other upstream 10720 26017176 ~ 26019400 (-)
AMCG00011485 cxcl14,LOC107598373,LOC107664788,LOC107567480,LOC107664739 other upstream 500487 26506943 ~ 26516507 (-)
G107713 NA other upstream 3618628 29625084 ~ 29625387 (-)
AMCG00011536 NA other upstream 3879760 29886216 ~ 29920020 (-)
AMCG00011543 rufy1,LOC102213688,LOC102302734,LOC100709430,LOC102791636,LOC106604316 other upstream 4185117 30191573 ~ 30233509 (-)

Expression


Co-expression Network