G107126


Basic Information

Item Value
gene id G107126
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030133.1
NCBI id CM030133.1
chromosome length 32682731
location 26387748 ~ 26387984 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU134002
GTAATTTCAAGACAGCCATAATGCGGTAATAAAATGTTAGCAGTTTGGAGTACACGAGTGCAGGTTGGCCTAAACGTTGTATCCTGGAGTAATCTGTTATTGATACATGTAAAAATGTCGAGCTTCATTAAACACTTTGGATGTGTTTAGGATTGTGGATTGAATTCATGGATAGGATGTATAGAACACGTTATAATGCGTTATTGCCCGTCAAGTCTGCTTGTATTCTAAACACAA

Function

GO: NA

KEGG:

id description
ko04660 T cell receptor signaling pathway
ko04658 Th1 and Th2 cell differentiation
ko04659 Th17 cell differentiation

RNA

RNA id representative length rna type GC content exon number start site end site
TU134002 True 237 lncRNA 0.37 1 26387748 26387984

Neighbor

gene id symbol gene type direction distance location
AMCG00011472 fbxo38 coding upstream 123221 26245927 ~ 26264527 (+)
AMCG00011471 fgfrl1b,LOC107740189,LOC107593239 coding upstream 145721 26240373 ~ 26242027 (+)
AMCG00011473 hspa9,LOC106604950,LOC106611979 coding upstream 188399 26189132 ~ 26199349 (+)
AMCG00011467 NA coding upstream 251970 26127315 ~ 26135778 (+)
AMCG00011468 LOC103355626 coding upstream 274894 26081951 ~ 26112854 (+)
AMCG00011483 hnrnpa0,roa0,LOC107598338,LOC105905838,LOC107567479 coding downstream 310 26388294 ~ 26397982 (+)
AMCG00011478 NA coding downstream 13981 26401965 ~ 26409373 (+)
AMCG00011477 klhl3,LOC106604937,LOC106611969 coding downstream 25317 26413301 ~ 26435458 (+)
AMCG00011491 LOC101077011,LOC100136477 coding downstream 522367 26910351 ~ 26923941 (+)
AMCG00011490 NA coding downstream 570158 26958142 ~ 26969283 (+)
G107098 NA non-coding upstream 95301 26277374 ~ 26292447 (+)
G107084 NA non-coding upstream 185129 26199950 ~ 26202619 (+)
G107004 ergic1 non-coding upstream 498910 25882692 ~ 25888838 (+)
G106994 NA non-coding upstream 592136 25795413 ~ 25795612 (+)
G106973 NA non-coding upstream 667162 25698252 ~ 25720586 (+)
G107128 NA non-coding downstream 59218 26447202 ~ 26451575 (+)
G107321 NA non-coding downstream 1079420 27467404 ~ 27468567 (+)
G107331 NA non-coding downstream 1109343 27497327 ~ 27501442 (+)
G107382 NA non-coding downstream 1225977 27613961 ~ 27615738 (+)
G107402 NA non-coding downstream 1402882 27790866 ~ 27874138 (+)
AMCG00011476 NA other upstream 26973 26356167 ~ 26360775 (+)
AMCG00011455 unc5a,LOC107677380,LOC107653334 other upstream 725569 25607986 ~ 25662179 (+)
AMCG00011430 dctn4,LOC107749746,LOC106604160 other upstream 2542837 23835819 ~ 23844911 (+)
G106711 zgc:175280,slc7a1,LOC107719755,LOC107702889,LOC107557764,LOC103353344,LOC106563607 other upstream 2634746 23748674 ~ 23753002 (+)
G106618 NA other upstream 3031189 23356062 ~ 23356559 (+)
G107202 NA other downstream 382454 26770438 ~ 26771214 (+)
AMCG00011488 NA other downstream 430068 26818052 ~ 26842792 (+)
G107394 NA other downstream 1324222 27712206 ~ 27727867 (+)
AMCG00011519 NA other downstream 2481158 28869142 ~ 28876355 (+)
G107741 NA other downstream 3309617 29697601 ~ 29699419 (+)

Expression


Co-expression Network