AMCG00012136


Basic Information

Item Value
gene id AMCG00012136
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030138.1
NCBI id CM030138.1
chromosome length 24262032
location 11386573 ~ 11388762 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00012136
ATGAGTGTGGCCAACAGAAAGGCAGCACCAGAGGCGGAGTGGTGGGCGGCATTCCCTGAGTTCTTGGTGATAAGGGGCAAGGTGGAGCCCACCTTGTCCTGCAGGAACTTGTCAAACATAGACATCTTGGTGAACTCCCTAGGCTGGGAGAGAGCAAGCTGCTGGGTCCTGGCTGGGATCACCAGTATGGGGTACGGCTGTGCAAACCCTGAATTCCCAGGGGTCTTCACCCGGGTCTCCAGCTTCCGGACCTGGATAAAGAAACACAGTGGGGTCTGA

Function

GO: NA

KEGG:

id description
ko04658 Th1 and Th2 cell differentiation
ko04659 Th17 cell differentiation

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00012136 True 279 mRNA 0.57 2 11386573 11388762

Neighbor

gene id symbol gene type direction distance location
AMCG00012128 NA coding upstream 3985 11360239 ~ 11382588 (+)
AMCG00012140 NA coding upstream 5801 11380073 ~ 11380772 (+)
AMCG00012127 mapk7 coding upstream 74529 11302454 ~ 11312044 (+)
AMCG00012122 NA coding upstream 137921 11247182 ~ 11248652 (+)
AMCG00012121 NA coding upstream 162289 11213608 ~ 11224284 (+)
AMCG00012138 NA coding downstream 14898 11403660 ~ 11405016 (+)
AMCG00012134 NA coding downstream 20682 11409444 ~ 11418782 (+)
AMCG00012137 NA coding downstream 47755 11436517 ~ 11440510 (+)
AMCG00012135 NA coding downstream 51750 11440512 ~ 11445488 (+)
AMCG00012142 NA coding downstream 77046 11465808 ~ 11469405 (+)
G134698 NA non-coding upstream 84508 11300334 ~ 11302065 (+)
G134692 NA non-coding upstream 152690 11233681 ~ 11233883 (+)
G134615 NA non-coding upstream 403779 10967276 ~ 10982794 (+)
G134556 NA non-coding upstream 533282 10849858 ~ 10853291 (+)
G134498 NA non-coding upstream 787732 10598539 ~ 10598841 (+)
G134749 NA non-coding downstream 115198 11503960 ~ 11504648 (+)
G134766 NA non-coding downstream 322488 11711250 ~ 11766411 (+)
G134779 NA non-coding downstream 430495 11819257 ~ 11844832 (+)
G134877 NA non-coding downstream 527582 11916344 ~ 11918265 (+)
G134879 NA non-coding downstream 535506 11924268 ~ 11926131 (+)
G134697 fus,LOC103040960,LOC107658502 other upstream 92674 11242229 ~ 11293899 (+)
AMCG00012112 NA other upstream 325543 11049065 ~ 11061030 (+)
G134613 NA other upstream 451466 10926606 ~ 10935107 (+)
AMCG00012088 NA other upstream 702476 10629684 ~ 10684097 (+)
G134343 NA other upstream 1068755 10303273 ~ 10317818 (+)
G134743 NA other downstream 47617 11436379 ~ 11446163 (+)
AMCG00012152 NA other downstream 230415 11619177 ~ 11870630 (+)
G134898 NA other downstream 642135 12030897 ~ 12031490 (+)
G134955 NA other downstream 783776 12172538 ~ 12172802 (+)
G134958 NA other downstream 792299 12181061 ~ 12181320 (+)

Expression


Co-expression Network