AMCG00012254


Basic Information

Item Value
gene id AMCG00012254
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030138.1
NCBI id CM030138.1
chromosome length 24262032
location 13979470 ~ 13982769 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00012254
ATGCTATCGTTGGAACGCAACGCAGAGAGTGCCATTGAGGCTCTGAAGGAGTATGAGCCAGAGATTGCAAAGGTGTACAGGACAGACAGGAAGAGTGTCCAGAGGATTAAGGCCAGAGAGCTCGTGCCTGGAGACATTGTGGATGTGGCTGCGGGCAAAGCCATTGGCGTGGTTGTGTCCACCGGCGTCTCCACAGAGATTGGCAAAATCCGCGACCAGATGGCGGCCACTGAGCAGGAGAAGACTCCCCTGCAGCAGAAGCTGGACGAGTTTGGCGAGCAGCTGTCCAAGGTCATCTCCCTGATCTGTGTTGCTGTCTGGCTCATCAACATTGGCCACTTCAACGACCCCGTGCACGGCGGCTCCTGGATCCGTGGTGCCATGTTCATCGTGGATAAAGTAGAGGGCGACAACTGCAGCCTGAATGAATTCAACATTTCTGGCTCCAAATATACCCCCGAGGGAGAAGTGTGA

Function

GO:

id name namespace
GO:0008152 metabolic process biological_process
GO:0006942 regulation of striated muscle contraction biological_process
GO:0034220 ion transmembrane transport biological_process
GO:0009612 response to mechanical stimulus biological_process
GO:0045932 negative regulation of muscle contraction biological_process
GO:0006816 calcium ion transport biological_process
GO:0006874 cellular calcium ion homeostasis biological_process
GO:0005783 endoplasmic reticulum cellular_component
GO:0044425 obsolete membrane part cellular_component
GO:0030017 sarcomere cellular_component
GO:0046872 metal ion binding molecular_function
GO:0019829 ATPase-coupled cation transmembrane transporter activity molecular_function
GO:0000166 nucleotide binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00012254 True 474 mRNA 0.55 4 13979470 13982769

Neighbor

gene id symbol gene type direction distance location
AMCG00012255 NA coding upstream 2246 13968531 ~ 13977224 (+)
AMCG00012246 LOC106606385,LOC102779737,LOC106597183,LOC107550235,LOC107550268 coding upstream 94340 13882244 ~ 13885130 (+)
AMCG00012244 LOC105897688,LOC103034594,LOC101477563,LOC103367324,LOC108280818,LOC105894037 coding upstream 102328 13860050 ~ 13877142 (+)
AMCG00012248 coro1c,LOC106937262,LOC105025598 coding upstream 137477 13838455 ~ 13841993 (+)
AMCG00012249 NA coding upstream 142650 13831581 ~ 13836820 (+)
AMCG00012252 LOC107755578,LOC107690283,LOC107729173,LOC107590562,LOC107567734 coding downstream 1695 13984464 ~ 13989166 (+)
AMCG00012251 NA coding downstream 66183 14048952 ~ 14057554 (+)
AMCG00012260 NA coding downstream 117331 14100100 ~ 14117969 (+)
AMCG00012263 NA coding downstream 203958 14186727 ~ 14199995 (+)
AMCG00012273 NA coding downstream 329518 14312287 ~ 14314436 (+)
G135366 NA non-coding upstream 23165 13927988 ~ 13956305 (+)
G135356 NA non-coding upstream 30643 13946316 ~ 13948827 (+)
G135355 NA non-coding upstream 73123 13905475 ~ 13906347 (+)
G135359 NA non-coding upstream 74179 13904716 ~ 13905291 (+)
G135358 NA non-coding upstream 74934 13902307 ~ 13904536 (+)
G135506 NA non-coding downstream 244221 14226990 ~ 14232263 (+)
G135540 NA non-coding downstream 385280 14368049 ~ 14368337 (+)
G135542 NA non-coding downstream 390271 14373040 ~ 14373945 (+)
G135575 NA non-coding downstream 535447 14518216 ~ 14521605 (+)
G135582 NA non-coding downstream 552755 14535524 ~ 14538864 (+)
AMCG00012247 NA other upstream 124415 13850378 ~ 13855055 (+)
AMCG00012245 NA other upstream 161925 13807213 ~ 13817545 (+)
G135264 NA other upstream 393554 13584270 ~ 13585916 (+)
G135240 NA other upstream 458976 13519421 ~ 13520494 (+)
AMCG00012228 NA other upstream 470671 13471101 ~ 13508799 (+)
AMCG00012253 NA other downstream 79468 14062237 ~ 14095797 (+)
AMCG00012262 LOC104967735 other downstream 191144 14173913 ~ 14183167 (+)
AMCG00012268 NA other downstream 263994 14246763 ~ 14296659 (+)
G135541 adprh,LOC107387950,LOC101076629,LOC105024377,LOC103481379,LOC103381590,LOC107094293 other downstream 392864 14375633 ~ 14377651 (+)
G135544 NA other downstream 394903 14377672 ~ 14378695 (+)

Expression


Co-expression Network