G132717 (nlgn2,LOC107386614,LOC106563375)


Basic Information

Item Value
gene id G132717
gene name nlgn2,LOC107386614,LOC106563375
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030138.1
NCBI id CM030138.1
chromosome length 24262032
location 4694438 ~ 4694805 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU166409
CCCAGTCTTGGCGAAGTTTGTCCAGTACGTCATAACCACAGCACTGAGCATGACATCGTTTTTGGAGAAGTTGCAAGGGAACAGGTCGGTGGCCCCGATCATGGGAATGCCAAAAACATATGGGATCTCATCGCCGTGTGCCGCGTCCGCCCACTCGGGCCGCGCCTCCGTCTGACAGTGGTGGTAGAAGGTGTAGAAGTAGACGGGTGACTGAAACTCGGCATGCAGCTTGGCAGTGGCCACCGCAGGCGCCACCCACTGATGATCAGTGAAAAGGGCCAGCAGGGTCTTGCGTCTCATCTCGCCATTGTCCCGGTCCGCCCAGTCGGTGTACATGAATTTGATGGTCTCCCGGAGAATGTCCTTTC

Function

symbol description
nlgn2 Predicted to enable cell adhesion molecule binding activity; neurexin family protein binding activity; and signaling receptor activity. Involved in positive regulation of insulin secretion. Acts upstream of or within positive regulation of protein localization to synapse. Predicted to be located in inhibitory synapse. Predicted to be integral component of postsynaptic membrane. Predicted to be active in GABA-ergic synapse; cell surface; and glycinergic synapse. Predicted to be integral component of postsynaptic specialization membrane.

NR:

description
PREDICTED: neuroligin-2-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU166409 True 368 lncRNA 0.57 1 4694438 4694805

Neighbor

gene id symbol gene type direction distance location
AMCG00011791 NA coding downstream 230352 4457441 ~ 4464086 (-)
AMCG00011788 NA coding downstream 319344 4364847 ~ 4375094 (-)
AMCG00011789 fgf11,LOC103358388 coding downstream 339195 4344336 ~ 4355243 (-)
AMCG00011787 NA coding downstream 367815 4293210 ~ 4326623 (-)
AMCG00011790 NA coding downstream 401535 4275059 ~ 4292903 (-)
AMCG00011799 NA coding upstream 26950 4721755 ~ 4731461 (-)
AMCG00011800 NA coding upstream 50435 4745240 ~ 4745536 (-)
AMCG00011798 NA coding upstream 71725 4766530 ~ 4769804 (-)
AMCG00011797 NA coding upstream 83524 4778329 ~ 4780490 (-)
AMCG00011802 NA coding upstream 111085 4805890 ~ 4807689 (-)
G132716 LOC102778775,LOC103391145 non-coding downstream 1196 4692750 ~ 4693242 (-)
G132711 NA non-coding downstream 121490 4572725 ~ 4572948 (-)
G132710 NA non-coding downstream 126314 4564215 ~ 4568124 (-)
G132707 NA non-coding downstream 167646 4526283 ~ 4526792 (-)
G132672 NA non-coding downstream 445405 4244942 ~ 4249033 (-)
G132747 NA non-coding upstream 116742 4811547 ~ 4811858 (-)
G132759 NA non-coding upstream 155915 4850720 ~ 4851002 (-)
G132819 NA non-coding upstream 324158 5018963 ~ 5019423 (-)
G132833 NA non-coding upstream 346178 5040983 ~ 5069667 (-)
G132862 NA non-coding upstream 467380 5162185 ~ 5163811 (-)
G132712 LOC105024602,LOC106563375,LOC105902387,LOC107564776 other downstream 99989 4593693 ~ 4594449 (-)
AMCG00011792 NA other downstream 201881 4482151 ~ 4492557 (-)
G132693 NA other downstream 217459 4474605 ~ 4476979 (-)
G132667 NA other downstream 475455 4218549 ~ 4218983 (-)
G132642 NA other downstream 527999 4164631 ~ 4166439 (-)
G132788 NA other upstream 309360 5004165 ~ 5004609 (-)
AMCG00011811 NA other upstream 447660 5142465 ~ 5150213 (-)
AMCG00011812 NA other upstream 595369 5290174 ~ 5328724 (-)
G133026 NA other upstream 1006281 5701086 ~ 5703917 (-)
G133032 smyhc1,LOC100136150,LOC103364123,LOC103375112,LOC101484004,LOC102294892,LOC102297239,LOC103482310,LOC106963427,LOC103135328 other upstream 1012478 5707283 ~ 5793845 (-)

Expression


Co-expression Network