G134840



Basic Information


Item Value
gene id G134840
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information


Item Value
chromosome id CM030138.1
NCBI id CM030138.1
chromosome length 24262032
location 11560097 ~ 11795338 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence


>TU169274
GGGGATTTCGCGGGAACGACGGATAGGACGAGGAGCTGCGCTTTTGATTTCCTGTCCGGATTAAACAAAAGAGGGCCGCCTGTCATGGCTGCTGCGCTGTAGAAGAGCTCTGACCCGGGAGAGAAGAGGACTGTGTTCAGGAGCAGGACCCAAAAAAGCAGCTGCAGGAGAAGCATCTTGATCCTCCTGGATTCTCACTGGACACTGAGCACTGACTCTCAACAACTACTGCAGCTCACTGGACACAGAGCACTGACTCTCAACAACTACTGCAGCTCACTGGACACTGAGCACTGACTCTCAACAACTACTGCAGCTCACTGGACACTGAGGACTGACTCTCAACAACTACTGCAGCTCACTGGACACAGAGCACT

Function


GO: NA

KEGG:

id description
ko04612 Antigen processing and presentation

RNA


RNA id representative length rna type GC content exon number start site end site
TU169274 True 377 lncRNA 0.53 6 11560097 11795338

Neighbor


gene id symbol gene type direction distance location
AMCG00012141 NA coding downstream 20007 11536026 ~ 11540090 (-)
AMCG00012139 NA coding downstream 171363 11382279 ~ 11388734 (-)
AMCG00012132 NA coding downstream 209160 11347488 ~ 11350937 (-)
AMCG00012129 kat8,LOC102799453 coding downstream 228816 11322207 ~ 11331281 (-)
AMCG00012130 NA coding downstream 240349 11312924 ~ 11319748 (-)
AMCG00012157 NA coding upstream 12661 11807999 ~ 11813611 (-)
AMCG00012156 NA coding upstream 47730 11843068 ~ 11866778 (-)
AMCG00012158 NA coding upstream 75899 11871237 ~ 11885827 (-)
AMCG00012160 NA coding upstream 95013 11890351 ~ 11896617 (-)
AMCG00012164 NA coding upstream 128983 11924321 ~ 11964818 (-)
G134819 NA non-coding downstream 159396 11395960 ~ 11400701 (-)
G134648 NA non-coding downstream 577306 10967276 ~ 10982791 (-)
G134451 NA non-coding downstream 1254070 10303569 ~ 10306027 (-)
G134443 NA non-coding downstream 1272968 10225627 ~ 10287129 (-)
G134404 NA non-coding downstream 1358872 10200802 ~ 10201225 (-)
G134899 NA non-coding upstream 219014 12014352 ~ 12017558 (-)
G134936 NA non-coding upstream 323002 12118340 ~ 12118592 (-)
G135002 NA non-coding upstream 471265 12266603 ~ 12266826 (-)
G135008 NA non-coding upstream 567197 12362535 ~ 12362840 (-)
G135148 NA non-coding upstream 771335 12566673 ~ 12589807 (-)
G134803 NA other downstream 173118 11330466 ~ 11386979 (-)
AMCG00012111 NA other downstream 598226 10934932 ~ 10961871 (-)
G134581 NA other downstream 748216 10729775 ~ 10811881 (-)
G134447 NA other downstream 1304059 10255526 ~ 10256038 (-)
G134445 NA other downstream 1308982 10250271 ~ 10251115 (-)
AMCG00012171 NA other upstream 278666 12074004 ~ 12107414 (-)
AMCG00012170 NA other upstream 314202 12109540 ~ 12122725 (-)
AMCG00012174 NA other upstream 394677 12190015 ~ 12213799 (-)
G134981 NA other upstream 425867 12221205 ~ 12223185 (-)
G135146 NA other upstream 772913 12568251 ~ 13426065 (-)

Expression



Co-expression Network