G135131


Basic Information

Item Value
gene id G135131
gene name NA
gene type non-coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030138.1
NCBI id CM030138.1
chromosome length 24262032
location 13372603 ~ 13397636 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>TU169667
ATGCTGTCCTAACAGAAGAGCCCCAGTCTGTGTTGTATGAGCTCCTCTCCAGGTGGGGACACTGGGCTCACAGGAAGCTGTGCTGCTGGACTGAGTGAATATTGCTGATGGTGCTGCTGTGGACTGGGCTCAGGTCAGCTGGGATTCCTCAGAGCCACTGACCCCCATGGAAAGCAGCTTGAAGAGCTGTTAGGGCTTCATTCAGGAATACTGGAGCTCTAGTTCCCAATCCAGCTCACACTGAGAGACTGTGTTTGTGGAGC

Function

GO: NA

KEGG:

id description
ko04612 Antigen processing and presentation

RNA

RNA id representative length rna type GC content exon number start site end site
TU169667 True 263 lncRNA 0.54 2 13372603 13397636

Neighbor

gene id symbol gene type direction distance location
AMCG00012224 mylpf,LOC108249004,LOC108443170 coding upstream 49214 13317915 ~ 13323389 (+)
AMCG00012223 NA coding upstream 65080 13303056 ~ 13307523 (+)
AMCG00012218 NA coding upstream 170211 13187382 ~ 13202392 (+)
AMCG00012212 NA coding upstream 189773 13166600 ~ 13182830 (+)
AMCG00012213 NA coding upstream 224029 13144427 ~ 13148574 (+)
AMCG00012227 NA coding downstream 128048 13525684 ~ 13527970 (+)
AMCG00012236 NA coding downstream 143517 13541153 ~ 13543947 (+)
AMCG00012229 pelo,LOC107674509 coding downstream 152418 13550054 ~ 13556902 (+)
AMCG00012242 NA coding downstream 298454 13696090 ~ 13700551 (+)
AMCG00012241 NA coding downstream 343603 13741239 ~ 13743991 (+)
G135117 NA non-coding upstream 74403 13287666 ~ 13298200 (+)
G135110 NA non-coding upstream 110549 13261759 ~ 13262054 (+)
G135067 NA non-coding upstream 124878 12959748 ~ 13247725 (+)
G135137 NA non-coding downstream 19769 13417405 ~ 13421051 (+)
G135138 NA non-coding downstream 29715 13427351 ~ 13427999 (+)
G135226 NA non-coding downstream 79926 13477562 ~ 13484478 (+)
G135250 NA non-coding downstream 133136 13530772 ~ 13531293 (+)
G135255 NA non-coding downstream 135062 13532698 ~ 13625360 (+)
AMCG00012217 NA other upstream 95632 13269196 ~ 13276971 (+)
G135070 NA other upstream 398550 12968377 ~ 12974053 (+)
G135038 NA other upstream 586543 12784088 ~ 12786060 (+)
G135037 NA other upstream 595446 12770783 ~ 12777157 (+)
AMCG00012191 NA other upstream 648409 12702323 ~ 12724194 (+)
G135058 NA other downstream 24799 13422435 ~ 13425359 (+)
AMCG00012228 NA other downstream 73465 13471101 ~ 13508799 (+)
G135240 NA other downstream 121785 13519421 ~ 13520494 (+)
G135264 NA other downstream 186634 13584270 ~ 13585916 (+)
AMCG00012245 NA other downstream 409577 13807213 ~ 13817545 (+)

Expression


Co-expression Network