AMCG00012635 (pde3a)


Basic Information

Item Value
gene id AMCG00012635
gene name pde3a
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 914435 ~ 920125 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00012635
TCCTCGGGCACCAGTGTGACAGTGGACATTGCAGTGATGGGAGAGGCTCATGGACTCATTACAGACCTCCTGGCCGACGCCTCTCTGCCCGCCAACACCTGCACCTCCCTCAGAGCGGTCAGCAACCTCCTCAGCACCCAGCTCACCTTCCAGCCTGTTCACCGGCCACGTGTCAATCCGTTGGTTTCCTTCAGTGAGGCCTACACCTGCTCTGATTCAGAGGAGGGACCTGAGAAGGGAGAGAAACTGGCCATTCCTAAGCGCTTGAGGCGGAGTCTCCCCCCTGGGCTACTGAGACGGATCTCCTCCACATGGACCACAACCACCTCAGCCACTGGTCTGCCAACCATCGAGCCAGGGCCTGTCAGGAGAGACCGCAGTGCCAGCATCAAGCCTGTTCATGAAACACCAACCTGC

Function

symbol description
pde3a Predicted to enable 3',5'-cyclic-AMP phosphodiesterase activity. Predicted to be involved in several processes, including cyclic-nucleotide-mediated signaling; negative regulation of cAMP-mediated signaling; and positive regulation of oocyte development. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in cytosol. Is expressed in oocyte and oocyte stage V. Human ortholog(s) of this gene implicated in hypertension and brachydactyly syndrome. Orthologous to human PDE3A (phosphodiesterase 3A).

NR:

description
PREDICTED: cGMP-inhibited 3',5'-cyclic phosphodiesterase A

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00012635 True 417 mRNA 0.59 2 914435 920125

Neighbor

gene id symbol gene type direction distance location
AMCG00012636 NA coding downstream 20818 866131 ~ 893617 (-)
AMCG00012638 NA coding downstream 97898 800059 ~ 816537 (-)
AMCG00012637 NA coding downstream 122053 767005 ~ 792382 (-)
AMCG00012634 LOC108427023,LOC106609119,LOC105893998,LOC102196680 coding downstream 162886 745335 ~ 751549 (-)
AMCG00012630 NA coding downstream 301228 599855 ~ 613207 (-)
AMCG00012640 NA coding upstream 93357 1013482 ~ 1037353 (-)
AMCG00012643 aebp2,LOC103380429,LOC101074123,LOC106609187 coding upstream 118644 1038769 ~ 1345918 (-)
AMCG00012642 NA coding upstream 440198 1360323 ~ 1582270 (-)
AMCG00012649 NA coding upstream 1395877 2316002 ~ 2317119 (-)
AMCG00012648 NA coding upstream 1399402 2319527 ~ 2345217 (-)
G38355 NA non-coding downstream 73948 837111 ~ 840487 (-)
G38305 NA non-coding downstream 317617 596608 ~ 596818 (-)
G38472 NA non-coding upstream 964504 1884629 ~ 1887591 (-)
G38473 NA non-coding upstream 980635 1900760 ~ 1901924 (-)
G38475 NA non-coding upstream 1074722 1994847 ~ 1995063 (-)
G38478 NA non-coding upstream 1111712 2031837 ~ 2032211 (-)
G38501 NA non-coding upstream 1374835 2294960 ~ 2295164 (-)
AMCG00012628 golt1b,LOC108428784,LOC107676462,LOC107701063 other downstream 374844 514222 ~ 539591 (-)
AMCG00012646 LOC107658747,LOC107707963 other upstream 658830 1578955 ~ 1817200 (-)
G38458 NA other upstream 856729 1776854 ~ 1777221 (-)
G38490 NA other upstream 1263760 2183885 ~ 2184163 (-)
AMCG00012732 NA other upstream 5132239 6052364 ~ 6063817 (-)
G39487 NA other upstream 5535596 6455721 ~ 6456178 (-)

Expression


Co-expression Network