AMCG00012677 (usf2,LOC101066260)


Basic Information

Item Value
gene id AMCG00012677
gene name usf2,LOC101066260
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 3980790 ~ 3990090 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00012677
GAGAGGCGGCGGAGAGATAAAATCAATAACTGGATCGTCACATTGTCTAAGATCATTCCAGACTGCAACACGGACAACAGCAAGACAGGAGCAAGTAAAGGTGGGATCCTGTCGAAGGCCTGTGACTATATTCGTGAATTGCGACAGAACAACCAGCGTTTGCAAGAAAGCTTCAAAGAGGTGGAGAGAGTACAGGTGGACAATGAGCTATTAAGACAA

Function

symbol description
usf2 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Orthologous to human USF2 (upstream transcription factor 2, c-fos interacting).

NR:

description
upstream stimulatory factor 2 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00012677 True 219 mRNA 0.46 2 3980790 3990090

Neighbor

gene id symbol gene type direction distance location
AMCG00012676 srpk2,LOC107552422 coding downstream 117366 3862048 ~ 3863424 (-)
AMCG00012673 LOC106910051 coding downstream 207803 3757095 ~ 3772987 (-)
AMCG00012671 NA coding downstream 225795 3738744 ~ 3754995 (-)
AMCG00012672 NA coding downstream 251144 3727446 ~ 3729646 (-)
AMCG00012674 mapk11,LOC108442323,LOC105020226,LOC103035641,LOC106609456,LOC107725929,LOC100700904,LOC108279456 coding downstream 259390 3678679 ~ 3721400 (-)
AMCG00012678 usf2,LOC105007924 coding upstream 25082 4015172 ~ 4024403 (-)
AMCG00012682 NA coding upstream 313905 4303995 ~ 4308720 (-)
AMCG00012683 NA coding upstream 359017 4349107 ~ 4367364 (-)
AMCG00012684 NA coding upstream 389783 4379873 ~ 4381284 (-)
AMCG00012688 ascl1a,ascl1,LOC107590149,LOC107664850,LOC107596391,LOC107744950 coding upstream 517537 4507627 ~ 4508220 (-)
G38909 NA non-coding downstream 4194 3974353 ~ 3976596 (-)
G38842 NA non-coding downstream 196740 3783804 ~ 3784050 (-)
G38841 NA non-coding downstream 197399 3783160 ~ 3783391 (-)
G38791 NA non-coding downstream 341924 3554385 ~ 3638866 (-)
G38792 NA non-coding downstream 418940 3506837 ~ 3561850 (-)
G38910 NA non-coding upstream 47349 4037439 ~ 4096741 (-)
G38965 NA non-coding upstream 136917 4127007 ~ 4517632 (-)
G39017 NA non-coding upstream 336993 4327083 ~ 4329635 (-)
G39160 NA non-coding upstream 795604 4785694 ~ 4786528 (-)
G39174 NA non-coding upstream 923913 4914003 ~ 4916594 (-)
G38490 NA other downstream 1796627 2183885 ~ 2184163 (-)
AMCG00012646 LOC107658747,LOC107707963 other downstream 2163590 1578955 ~ 1817200 (-)
G38458 NA other downstream 2203569 1776854 ~ 1777221 (-)
AMCG00012628 golt1b,LOC108428784,LOC107676462,LOC107701063 other downstream 3441199 514222 ~ 539591 (-)
AMCG00012732 NA other upstream 2062274 6052364 ~ 6063817 (-)
G39487 NA other upstream 2465631 6455721 ~ 6456178 (-)
AMCG00012751 NA other upstream 2648390 6638480 ~ 6695924 (-)
AMCG00012782 NA other upstream 3901399 7891489 ~ 7904455 (-)
AMCG00012829 NA other upstream 5122351 9112441 ~ 9152405 (-)

Expression


Co-expression Network