AMCG00012678 (usf2,LOC105007924)


Basic Information

Item Value
gene id AMCG00012678
gene name usf2,LOC105007924
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 4015172 ~ 4024403 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00012678
GCGGTGATACAGAACCCCTTCAGCAATGGTGGTAGTCCAGCCACAGACACAGTCAGCGGAGAGACACGTTTTGCCTACTTCCCTGCGTCCACTGTGGGTGACGGCACGGCTACAACGTTATCGGTGCAGGCCGCCGACCCCACCCTTGCACAGGCTGGCGGTCAATTTTATGTGATGATGACTCCCCCAGATGTTCTGCAGTCAGGAACACCCAGAACAATTGCACCAAGGACACATCCGTACTCA

Function

symbol description
usf2 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Orthologous to human USF2 (upstream transcription factor 2, c-fos interacting).

NR:

description
upstream stimulatory factor 2 isoform X2

GO:

id name namespace
GO:0046983 protein dimerization activity molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00012678 True 246 mRNA 0.56 2 4015172 4024403

Neighbor

gene id symbol gene type direction distance location
AMCG00012677 usf2,LOC101066260 coding downstream 25082 3980790 ~ 3990090 (-)
AMCG00012676 srpk2,LOC107552422 coding downstream 151748 3862048 ~ 3863424 (-)
AMCG00012673 LOC106910051 coding downstream 242185 3757095 ~ 3772987 (-)
AMCG00012671 NA coding downstream 260177 3738744 ~ 3754995 (-)
AMCG00012672 NA coding downstream 285526 3727446 ~ 3729646 (-)
AMCG00012682 NA coding upstream 279592 4303995 ~ 4308720 (-)
AMCG00012683 NA coding upstream 324704 4349107 ~ 4367364 (-)
AMCG00012684 NA coding upstream 355470 4379873 ~ 4381284 (-)
AMCG00012688 ascl1a,ascl1,LOC107590149,LOC107664850,LOC107596391,LOC107744950 coding upstream 483224 4507627 ~ 4508220 (-)
AMCG00012690 NA coding upstream 599512 4623915 ~ 4642672 (-)
G38909 NA non-coding downstream 38576 3974353 ~ 3976596 (-)
G38842 NA non-coding downstream 231122 3783804 ~ 3784050 (-)
G38841 NA non-coding downstream 231781 3783160 ~ 3783391 (-)
G38791 NA non-coding downstream 376306 3554385 ~ 3638866 (-)
G38792 NA non-coding downstream 453322 3506837 ~ 3561850 (-)
G38910 NA non-coding upstream 13036 4037439 ~ 4096741 (-)
G38965 NA non-coding upstream 102604 4127007 ~ 4517632 (-)
G39017 NA non-coding upstream 302680 4327083 ~ 4329635 (-)
G39160 NA non-coding upstream 761291 4785694 ~ 4786528 (-)
G39174 NA non-coding upstream 889600 4914003 ~ 4916594 (-)
G38490 NA other downstream 1831009 2183885 ~ 2184163 (-)
AMCG00012646 LOC107658747,LOC107707963 other downstream 2197972 1578955 ~ 1817200 (-)
G38458 NA other downstream 2237951 1776854 ~ 1777221 (-)
AMCG00012628 golt1b,LOC108428784,LOC107676462,LOC107701063 other downstream 3475581 514222 ~ 539591 (-)
AMCG00012732 NA other upstream 2027961 6052364 ~ 6063817 (-)
G39487 NA other upstream 2431318 6455721 ~ 6456178 (-)
AMCG00012751 NA other upstream 2614077 6638480 ~ 6695924 (-)
AMCG00012782 NA other upstream 3867086 7891489 ~ 7904455 (-)
AMCG00012829 NA other upstream 5088038 9112441 ~ 9152405 (-)

Expression


Co-expression Network