AMCG00012828 (btg1,LOC106609569)


Basic Information

Item Value
gene id AMCG00012828
gene name btg1,LOC106609569
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 9251194 ~ 9254555 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00012828
AGGACCTCGAAACAAGGGACAGACTCCGCCTTTCCGAAAAAAGGCCCCAGTAAAACCCCGAGAGCAGGCTCCGTGCGATCCCACCTCGTCCCTTCCTCAATGCATACTCTGTGTACACGGGCCAGTATGAAACCCGAGATCACCGCAGCCGTGGGATTTCTATCCAGATTTCTGAGGACAAAGGGGCTTGTAAATGACCGACAGTTACAAACATTCGGCCAGTCCCTCCAGGATCTGATGGCAGAACAGTACAAGCACCACTGGTTCCCAGACAGGCCTTGCAAAGGATCCGGCTACCGCTGCATCCGCATCAACCACAAAATGGATCCGCTGGTGGGACAGGCGGCGCAGAGGATAGGACTCAGCATACAACAGTTGTATCGGCTCCTGCCCAGCGAGCTCACACTGTGGGTTGACCCCTTTGAAGTGTCCTATCGCATCGGGGAAGATGGGTCTATCTGCGTGCTGTACGAGTCCCAGCCGGTGGTGGTCAGCAACCAGAATCCCGGGGGAGGCAGCCTAGGAATGATGGACAGTCGCATCAGCTGTAAGGAGGAACTACTGCTGGGGAGAACCAGTCCTTCCAAAACGTACAACATGATGACTGTGTCCAGTTAA

Function

symbol description
btg1 Predicted to be involved in negative regulation of cell population proliferation and negative regulation of mitotic cell cycle. Predicted to be active in cytoplasm and nucleus. Is expressed in several structures, including cardiovascular system; ectoderm; mesoderm; nervous system; and neural tube. Orthologous to human BTG1 (BTG anti-proliferation factor 1).

NR:

description
PREDICTED: protein BTG1

GO: NA

KEGG:

id description
K14443 TOB; protein Tob/BTG

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00012828 True 618 mRNA 0.55 2 9251194 9254555

Neighbor

gene id symbol gene type direction distance location
AMCG00012819 NA coding upstream 139418 9095412 ~ 9111776 (+)
AMCG00012816 NA coding upstream 173293 9064317 ~ 9077901 (+)
AMCG00012817 nfyb,LOC106561000,LOC107658836,LOC107656315,LOC107592261,LOC107743639,LOC107696291 coding upstream 207653 9039322 ~ 9043541 (+)
AMCG00012815 NA coding upstream 379036 8854081 ~ 8872158 (+)
AMCG00012810 aldh1l2,LOC106576152,LOC106609325,LOC107743541 coding upstream 406843 8823497 ~ 8844351 (+)
AMCG00012832 NA coding downstream 120612 9375167 ~ 9382501 (+)
AMCG00012833 NA coding downstream 157771 9412326 ~ 9469248 (+)
AMCG00012834 NA coding downstream 379679 9634234 ~ 9691339 (+)
AMCG00012835 NA coding downstream 447715 9702270 ~ 9723930 (+)
AMCG00012836 snd1,LOC107738807 coding downstream 497081 9751636 ~ 9770671 (+)
G40041 NA non-coding upstream 157348 9091314 ~ 9093846 (+)
G40022 NA non-coding upstream 197375 9051087 ~ 9053819 (+)
G39951 NA non-coding upstream 583730 8666754 ~ 8667464 (+)
G39838 NA non-coding upstream 981973 8268994 ~ 8269221 (+)
G39776 NA non-coding upstream 1118630 8057019 ~ 8132564 (+)
G40119 NA non-coding downstream 10323 9264878 ~ 9265093 (+)
G40121 NA non-coding downstream 39776 9294331 ~ 9294642 (+)
G40145 NA non-coding downstream 218990 9473545 ~ 9473868 (+)
G40146 NA non-coding downstream 219418 9473973 ~ 9474220 (+)
G40203 NA non-coding downstream 917699 10172254 ~ 10172463 (+)
AMCG00012820 nt5dc3,LOC102307862,LOC107753643 other upstream 120983 9112460 ~ 9130211 (+)
AMCG00012818 NA other upstream 165494 9083662 ~ 9085700 (+)
AMCG00012803 sult4a1,LOC102784496,LOC106576158 other upstream 681303 8536233 ~ 8569891 (+)
AMCG00012797 NA other upstream 905339 8335898 ~ 8345855 (+)
G39709 LOC101154678 other upstream 1414980 7835346 ~ 7836214 (+)
G40224 NA other downstream 1182352 10436907 ~ 10444447 (+)
AMCG00012848 NA other downstream 1286173 10540728 ~ 10541960 (+)
AMCG00012894 gdi2,LOC107585127,LOC107560733,LOC107754057,LOC107694307,LOC107757239 other downstream 3198684 12453239 ~ 12500402 (+)
G40629 NA other downstream 3234020 12488575 ~ 12535929 (+)
G40999 metap2,LOC108428789,LOC100194705 other downstream 5173758 14428313 ~ 14433201 (+)

Expression


Co-expression Network