AMCG00012979 (ascl4)


Basic Information

Item Value
gene id AMCG00012979
gene name ascl4
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 15536669 ~ 15537223 (-)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00012979
ATGACAACTGATCACACAGAGAGTTTCATGGACCTGCTGCCCAACCCAAGGTCCGTGTCCATTAGTTTCCCGCTGGATCACCCAGGAGTTGCACTGAGAGAGCCGTTCAGGTGGTCGTTTCCTGTAGACCCCTCATGTTTGCATCAAGCTTACCCCCACAGATACACGGGACGGTTCTCCTATGTGCCTTTCCCTGAACACCTGGGGGTCTATGACTACTCGTTTGAGCCAACCTTCATCAGGAAACGCAACGAGCGGGAGAGACAGAGGGTGCGCTGTGTGAATGAGGGTTACGCCCGTCTCCGCCAGCATCTCCCACAGGAGTTTGAGGACAAGCGCTTGAGCAAAGTGGAGACCCTCAGAGCAGCCATCAGCTATATCAGACATCTCCAGGACCTGCTGGATGTCCATGTTTCTGACGCTTCCTCAAAGGAAAGACCGCTGTCTTGTAAAAATCCCACCGGTCCTTCGGGGTCCCTGCAGAGGACAACAGACTGCAGCAGCGACGCAGAATCAAAGATCAGCTTCAGCGATAGCGGAGACATGAGCAGCTAG

Function

symbol description
ascl4 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be part of RNA polymerase II transcription regulator complex and chromatin.

NR:

description
PREDICTED: achaete-scute homolog 4

GO: NA

KEGG:

id description
K09067 ASCL; achaete-scute complex protein

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00012979 True 555 mRNA 0.54 1 15536669 15537223

Neighbor

gene id symbol gene type direction distance location
AMCG00012975 pik3cg,LOC106609208,LOC107656384,LOC107583938,LOC107590535 coding downstream 13740 15512472 ~ 15522929 (-)
AMCG00012977 prkar2b,LOC101073002 coding downstream 27147 15492361 ~ 15509522 (-)
AMCG00012969 NA coding downstream 50683 15477886 ~ 15485986 (-)
AMCG00012967 NA coding downstream 124024 15405765 ~ 15412645 (-)
AMCG00012966 LOC107734741 coding downstream 157721 15376476 ~ 15378948 (-)
AMCG00012976 si:dkey-180p18.9,LOC107725652 coding upstream 16976 15554199 ~ 15565616 (-)
AMCG00012981 slc13a4 coding upstream 33770 15570993 ~ 15595338 (-)
AMCG00012984 NA coding upstream 188771 15725994 ~ 15758670 (-)
AMCG00012989 NA coding upstream 266734 15803957 ~ 15808685 (-)
AMCG00012995 NA coding upstream 377005 15914228 ~ 15924404 (-)
G41243 NA non-coding downstream 258357 15237290 ~ 15278312 (-)
G41224 NA non-coding downstream 300807 15235620 ~ 15235862 (-)
G41191 NA non-coding downstream 458849 15075434 ~ 15077820 (-)
G41138 NA non-coding downstream 614353 14842243 ~ 14922316 (-)
G41102 NA non-coding downstream 800040 14733735 ~ 14736629 (-)
G41369 NA non-coding upstream 29286 15566509 ~ 15569851 (-)
G41386 NA non-coding upstream 101656 15638879 ~ 15639990 (-)
G41402 NA non-coding upstream 253069 15790292 ~ 15822009 (-)
G41442 NA non-coding upstream 418212 15955435 ~ 15956038 (-)
G41443 NA non-coding upstream 418876 15956099 ~ 15959544 (-)
AMCG00012931 snrpf other downstream 1192197 14340416 ~ 14344472 (-)
G40778 LOC107575789 other downstream 2421182 13114893 ~ 13115487 (-)
AMCG00012906 kin other downstream 2630336 12896520 ~ 12906333 (-)
AMCG00012888 mkln1,LOC107104017 other downstream 3264880 12240396 ~ 12271789 (-)
AMCG00012856 lsm8,LOC107592220,LOC107580766,LOC107656302 other downstream 4674347 10857881 ~ 10862322 (-)
AMCG00012985 NA other upstream 182290 15719513 ~ 15722457 (-)
AMCG00013018 NA other upstream 1093008 16630231 ~ 16639087 (-)
AMCG00013038 NA other upstream 2343002 17880225 ~ 17910017 (-)
AMCG00013042 NA other upstream 2392675 17929898 ~ 18046714 (-)
G41807 NA other upstream 2638838 18176061 ~ 18191522 (-)

Expression


Co-expression Network