AMCG00013119 (LOC106565367,LOC777984)


Basic Information

Item Value
gene id AMCG00013119
gene name LOC106565367,LOC777984
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 21399406 ~ 21400312 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00013119
CCTGAGAAGGAGAGGATTGAGGCTCAGAGCAAACCATTTGATGCCAAATCTGCCGTCTATGTAACTGATGCCAAGGAGCTGTATGTCAAAGGTGTGGTCCAAAGTAGGGAAGGGGGCAAAGCTACTGTCAAGACTGAGGCTGGCCAAACTGTCACAGTCAAGGAGGATGACGTCTTCCCAATGAATCCTCCCAAGTACGACAAAATTGAGGACATGGCGATGATGACCCACCTGAATGAAGCCTCTGTGCTGTATAACCTCAAAGAGCGTTACGCAGCATGGATGATTTACACCTACTCTGGGCTGTTTTGTGCAACTGTGAACCCCTACAAGTGGCTGCCAGTGTATGATCAATCAGTTGTGACAGCCTACAGAGGCAAAAAGCGCATGGAGGCTCCACCACACATCTTCTCTGTCTCTGATAATGCCTATCAGAACATGCTCACTGATCGTGAGAACCAGTCCGTCCTGATTACTGGAGAATCTGGTGCTGGAAAGACTGTGAACACGAAACGTGTCATCCAGTACTTTGCGACAATCGCA

Function

NR:

description
PREDICTED: myosin heavy chain, fast skeletal muscle-like

GO:

id name namespace
GO:0014823 response to activity biological_process
GO:0016459 myosin complex cellular_component
GO:0005524 ATP binding molecular_function
GO:0003774 motor activity molecular_function
GO:0003779 actin binding molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00013119 True 543 mRNA 0.49 5 21399406 21400312

Neighbor

gene id symbol gene type direction distance location
AMCG00013128 LOC106597527,LOC106569817,LOC106606262,LOC106596646,LOC106585883,LOC106596400 coding upstream 36493 21362315 ~ 21362913 (+)
AMCG00013121 NA coding upstream 39699 21350662 ~ 21359707 (+)
AMCG00013123 NA coding upstream 54343 21343864 ~ 21345063 (+)
AMCG00013122 LOC108261602,LOC108254796 coding upstream 55679 21341010 ~ 21343727 (+)
AMCG00013108 NA coding upstream 113568 21270056 ~ 21285838 (+)
AMCG00013124 LOC103370545,LOC102292730,LOC777984,LOC100705928,LOC102793686,LOC100710639,LOC101481850,LOC102288653 coding downstream 21310 21421622 ~ 21448718 (+)
AMCG00013120 myhz1.2,myhz1.1,myhc4 coding downstream 75306 21475618 ~ 21481280 (+)
AMCG00013140 wu:fd14a01 coding downstream 75948 21476260 ~ 21481280 (+)
AMCG00013142 LOC108412647 coding downstream 85919 21486231 ~ 21486678 (+)
AMCG00013125 LOC108412647 coding downstream 85919 21486231 ~ 21486693 (+)
G42330 LOC106589491,LOC105023009,LOC103368359,LOC100710639,LOC102784652,LOC102295130 non-coding upstream 95193 21256585 ~ 21304213 (+)
G42277 NA non-coding upstream 509074 20889675 ~ 20890332 (+)
G42269 NA non-coding upstream 558846 20839589 ~ 20840560 (+)
G42177 NA non-coding upstream 772072 20627094 ~ 20627334 (+)
G42172 NA non-coding upstream 847589 20551260 ~ 20551817 (+)
G42345 LOC777982,LOC104957706 non-coding downstream 72404 21472716 ~ 21508824 (+)
G42347 NA non-coding downstream 98661 21498973 ~ 21503924 (+)
G42350 NA non-coding downstream 128469 21528781 ~ 21600968 (+)
G42448 NA non-coding downstream 747982 22148294 ~ 22148513 (+)
G42449 NA non-coding downstream 749273 22149585 ~ 22149787 (+)
G42326 LOC105030495,LOC106938339,LOC103143718,LOC103461378 other upstream 120678 21269675 ~ 21278728 (+)
G41978 NA other upstream 2370128 19025561 ~ 19029278 (+)
AMCG00013068 NA other upstream 2425044 18967429 ~ 18974362 (+)
AMCG00013047 NA other upstream 3169168 18158842 ~ 18230238 (+)
AMCG00013015 NA other upstream 4669873 16719355 ~ 16729533 (+)
G42344 LOC108412647 other downstream 26348 21426660 ~ 21486808 (+)
G42453 NA other downstream 842117 22242429 ~ 22245790 (+)
AMCG00013147 NA other downstream 848185 22248497 ~ 22260816 (+)
AMCG00013198 NA other downstream 2840957 24241269 ~ 24331854 (+)
G42846 NA other downstream 3347180 24747492 ~ 24749395 (+)

Expression


Co-expression Network