AMCG00013312


Basic Information

Item Value
gene id AMCG00013312
gene name NA
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 27952383 ~ 27953343 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00013312
ATGGATCACCACAGGGAGAGCACAAGCAAGAAGCCGGCCAAGAATAAAACGTCCAAGCGCAAGGAGAAGAAACACAAACCCGGGAGGCTGTTCAGGAGGAAATCGCTCAAGTCGGTGGGGCATTTCATGAACCGGATTCTGAAAACTCTGGGCACTTTGGCGCACTTCGGCGACCCCGACGCGCCCGACCTGGAGGACGACGACGGGGGGTTTCGGGACGGGACCCCCTGCACGCTCAGTGCCAACTCAGGAAACCTGCAGGACGAGGTCCAGGCCGGCGGGGACAACCCGGGGAAGAAGAGCTCGACCCTGTCCTCCCACGGGTCCACCAAGGAGCGCCTGTCGTGGGGCTTCGGGGACAAGACGCCGGGCGTCCTGGGCTTGAAGAACCACGGCAACACCTGCTTCATGAACGCGGTGGTCCAGTGCCTGAGCAACACGGACCTGCTGGCCGAGTACCTGGGGCTGGAGCAGTACAAGCCCGACGTCAACGGGCTGCTGAGGAGCGAGGAGCCGGCCGTCACCGAGGTGCTGGCCTCGGTGGTGCGGGCGCTGTGGACGCTGGAGTACACGCCGCAGCTGTCCGTGGAGTTCAAGCGTAGTGACGCTTCCGTGAATCCGCACAGGTGA

Function

GO:

id name namespace
GO:0002011 morphogenesis of an epithelial sheet biological_process
GO:0055113 epiboly involved in gastrulation with mouth forming second biological_process
GO:0090504 epiboly biological_process
GO:0001702 gastrulation with mouth forming second biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00013312 True 630 mRNA 0.63 2 27952383 27953343

Neighbor

gene id symbol gene type direction distance location
AMCG00013311 NA coding upstream 5548 27936413 ~ 27946835 (+)
AMCG00013308 LOC107555375,LOC107733905,LOC107704007,LOC105903456,LOC105012279 coding upstream 76899 27874493 ~ 27875484 (+)
AMCG00013307 ntn1a,LOC107733905,LOC106564677,LOC107555375,LOC106587088 coding upstream 138220 27811693 ~ 27814163 (+)
AMCG00013299 ndel1,LOC108432229,LOC104940291,LOC107672491 coding upstream 342915 27592775 ~ 27609468 (+)
AMCG00013296 NA coding upstream 383088 27548805 ~ 27569295 (+)
AMCG00013316 grb2,grb2b,LOC105013161,LOC106523871,LOC107719324 coding downstream 207987 28161330 ~ 28166776 (+)
AMCG00013315 NA coding downstream 219408 28172751 ~ 28179801 (+)
AMCG00013321 mif4gd,mif4gdb,LOC106606581,LOC107553652,LOC106601806,LOC107570710 coding downstream 237092 28190435 ~ 28196943 (+)
AMCG00013322 NA coding downstream 246466 28199809 ~ 28208595 (+)
AMCG00013320 sumo2,sumo2b,LOC106606624,LOC108411789,LOC106564670 coding downstream 265723 28219066 ~ 28224436 (+)
G43438 NA non-coding upstream 534596 27270028 ~ 27417787 (+)
G43402 NA non-coding upstream 941732 27010372 ~ 27010651 (+)
G43326 NA non-coding upstream 1022130 26872821 ~ 26930253 (+)
G43303 NA non-coding upstream 1166822 26784953 ~ 26785561 (+)
G43138 NA non-coding upstream 2107789 25807419 ~ 25844594 (+)
G43673 NA non-coding downstream 436346 28389689 ~ 28389960 (+)
G43712 NA non-coding downstream 784780 28738123 ~ 28738753 (+)
G43810 NA non-coding downstream 1196635 29149978 ~ 29151334 (+)
G43799 NA non-coding downstream 1203356 29156699 ~ 29158493 (+)
G43853 NA non-coding downstream 1223708 29177051 ~ 29178266 (+)
AMCG00013310 NA other upstream 16445 27928708 ~ 27935938 (+)
G43476 NA other upstream 361565 27589139 ~ 27590818 (+)
AMCG00013298 NA other upstream 537097 27385665 ~ 27415286 (+)
G43434 NA other upstream 793662 27158302 ~ 27158721 (+)
AMCG00013286 pde6g,LOC102221623,LOC103367935,LOC102781464 other upstream 1047420 26897509 ~ 26904963 (+)
AMCG00013317 NA other downstream 54171 28007514 ~ 28072799 (+)
G43682 NA other downstream 530930 28484273 ~ 28488783 (+)
AMCG00013336 NA other downstream 723199 28676542 ~ 28686138 (+)
G43802 NA other downstream 1150946 29104289 ~ 29104577 (+)
AMCG00013364 cacng5,cacng5b,LOC107586339,LOC107569463,LOC107716884,LOC107688812,LOC107710162,LOC108437158,LOC107710696,LOC107698772 other downstream 1687280 29640623 ~ 29667051 (+)

Expression


Co-expression Network