AMCG00013316 (grb2,grb2b,LOC105013161,LOC106523871,LOC107719324)


Basic Information

Item Value
gene id AMCG00013316
gene name grb2,grb2b,LOC105013161,LOC106523871,LOC107719324
gene type coding
species bowfin (Amia calva)
category of species ecological fish

Chromosome Information

Item Value
chromosome id CM030125.1
NCBI id CM030125.1
chromosome length 49972098
location 28161330 ~ 28166776 (+)
genome version AmiCal1_2021_bowfin_Genome

Sequence

>AMCG00013316
GTTTTAAATGAAGAATGTGACCAAAACTGGTACAAGGCAGAGCTCAACGGAAAGGACGGCTTCATTCCCAAGAACTACATTGAAATGAAAGCACATCCGTGGTTCTTTGGTAAGATCCCCCGGGCAAAGGCAGAGGAGATGCTGAACAAGCAGAGACACGATGGCGCCTTCCTCATCCGGGAGAGCGAGAGCGCGCCAGGAGACTTCTCGTTGTCCGTAAAGTTTGGAAACGACGTCCAACACTTCAAGGTCCTCCGTGACGGGGCGGGGAAGTATTTCCTCTGGGTGGTGAAGTTCAACTCCCTGAACGAGCTGGTGGACTATCACCGGTCCACGTCGGTGTCGCGGAACCAGCAGATATTCCTGCGAGACATAGAGCAGGTCCCCCAGCATCCAACGTACGTGCAGGCCCTGTTCGACTTCGACCCACAGGAGGATGGAGAGCTGGGCTTCCGGCGCGGGGACTTCATCCAGGTGCTCGACAACTCTGACCCCAACTGGTGGAAGGGGGCCTGTCACGGCCAGACGGGCATGTTCCCGCGCAACTACGTCAACCCGGTCAACCGGAACATGTAA

Function

symbol description
grb2b Predicted to be located in Golgi apparatus; endosome; and nucleus. Is expressed in central nervous system and trigeminal placode. Human ortholog(s) of this gene implicated in breast cancer; prostate adenocarcinoma; and prostate cancer. Orthologous to human GRB2 (growth factor receptor bound protein 2).
grb2 Enables several functions, including SH3 domain binding activity; insulin receptor substrate binding activity; and signaling receptor binding activity. Involved in several processes, including cellular response to ionizing radiation; signal transduction in response to DNA damage; and transmembrane receptor protein tyrosine kinase signaling pathway. Acts upstream of or within actin cytoskeleton reorganization. Located in endosome; nucleolus; and nucleoplasm. Part of COP9 signalosome and Grb2-EGFR complex. Implicated in breast cancer; prostate adenocarcinoma; and prostate cancer. Biomarker of endometrial carcinoma.

NR:

description
PREDICTED: growth factor receptor-bound protein 2

GO: NA

KEGG:

id description
K04364 GRB2; growth factor receptor-bound protein 2

RNA

RNA id representative length rna type GC content exon number start site end site
AMCG00013316 True 576 mRNA 0.56 4 28161330 28166776

Neighbor

gene id symbol gene type direction distance location
AMCG00013312 NA coding upstream 207987 27952383 ~ 27953343 (+)
AMCG00013311 NA coding upstream 214495 27936413 ~ 27946835 (+)
AMCG00013308 LOC107555375,LOC107733905,LOC107704007,LOC105903456,LOC105012279 coding upstream 285846 27874493 ~ 27875484 (+)
AMCG00013307 ntn1a,LOC107733905,LOC106564677,LOC107555375,LOC106587088 coding upstream 347167 27811693 ~ 27814163 (+)
AMCG00013299 ndel1,LOC108432229,LOC104940291,LOC107672491 coding upstream 551862 27592775 ~ 27609468 (+)
AMCG00013315 NA coding downstream 5975 28172751 ~ 28179801 (+)
AMCG00013321 mif4gd,mif4gdb,LOC106606581,LOC107553652,LOC106601806,LOC107570710 coding downstream 23659 28190435 ~ 28196943 (+)
AMCG00013322 NA coding downstream 33033 28199809 ~ 28208595 (+)
AMCG00013320 sumo2,sumo2b,LOC106606624,LOC108411789,LOC106564670 coding downstream 52290 28219066 ~ 28224436 (+)
AMCG00013324 NA coding downstream 60793 28227569 ~ 28234482 (+)
G43438 NA non-coding upstream 743543 27270028 ~ 27417787 (+)
G43402 NA non-coding upstream 1150679 27010372 ~ 27010651 (+)
G43326 NA non-coding upstream 1231077 26872821 ~ 26930253 (+)
G43303 NA non-coding upstream 1375769 26784953 ~ 26785561 (+)
G43138 NA non-coding upstream 2316736 25807419 ~ 25844594 (+)
G43673 NA non-coding downstream 222913 28389689 ~ 28389960 (+)
G43712 NA non-coding downstream 571347 28738123 ~ 28738753 (+)
G43810 NA non-coding downstream 983202 29149978 ~ 29151334 (+)
G43799 NA non-coding downstream 989923 29156699 ~ 29158493 (+)
G43853 NA non-coding downstream 1010275 29177051 ~ 29178266 (+)
AMCG00013317 NA other upstream 88531 28007514 ~ 28072799 (+)
AMCG00013310 NA other upstream 225392 27928708 ~ 27935938 (+)
G43476 NA other upstream 570512 27589139 ~ 27590818 (+)
AMCG00013298 NA other upstream 746044 27385665 ~ 27415286 (+)
G43434 NA other upstream 1002609 27158302 ~ 27158721 (+)
G43682 NA other downstream 317497 28484273 ~ 28488783 (+)
AMCG00013336 NA other downstream 509766 28676542 ~ 28686138 (+)
G43802 NA other downstream 937513 29104289 ~ 29104577 (+)
AMCG00013364 cacng5,cacng5b,LOC107586339,LOC107569463,LOC107716884,LOC107688812,LOC107710162,LOC108437158,LOC107710696,LOC107698772 other downstream 1473847 29640623 ~ 29667051 (+)
AMCG00013375 bptf,LOC105013188,LOC106607015,LOC103359999 other downstream 1718986 29885762 ~ 29928697 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) CI01000034_00393749_00410314 GRB2A, GRB2B, GRB2, GRB2.S, GRB2.L coding CI01000034 null 393660 ~ 410338 (+)